Source: CLINVAR

Variant Gene DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Num. diseases
rs786205241 1.000 0.036 11 2884860 frameshift variant G/GGGGGCCGGGGCC,GGGGGCC,GGGGGCCGGAGC in-del 1
rs7675998 1.000 0.071 4 163086668 intergenic variant A/G,T snp 1.0E-03; 0.79 1
rs398652 1.000 0.071 14 56058851 intergenic variant G/A snp 0.26 1
rs587776763 1.000 0.071 2 233760761 frameshift variant C/CT in-del 1
rs587776762 1.000 0.071 2 233760800 inframe deletion TCTT/T in-del 1
rs41362547 MT 10044 non coding transcript exon variant snp 1
rs5030952 1.000 0.071 2 240603286 intron variant C/G,T snp 0.20 1
rs193922936 1.000 0.071 X 147912051 splice acceptor variant GCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG/G. microsatellite 1
rs606231176 1.000 0.214 MT 5888 non coding transcript exon variant in-del 1
rs118203893 1.000 0.214 MT 5877 non coding transcript exon variant snp 1
rs199474667 1.000 0.214 MT 3249 non coding transcript exon variant snp 1
rs118203892 1.000 0.214 MT 5885 non coding transcript exon variant in-del 1
rs587776441 1.000 0.107 MT 1644 non coding transcript exon variant snp 1
rs370471013 1.000 0.107 MT 5559 non coding transcript exon variant snp 1
rs587776435 1.000 0.107 MT 5523 non coding transcript exon variant snp 1
rs387906428 1.000 0.107 X 134500063 stop lost AAAATACAAAGCCTAAGATGAG/A in-del 1
rs606231177 MT 4369 non coding transcript exon variant in-del 1
rs199474699 MT 15990 non coding transcript exon variant snp 1
rs199476140 MT 4366 non coding transcript exon variant in-del 1
rs727505368 12 37253847 intergenic variant G/C,T snp 1
rs199474665 1.000 0.036 MT 3290 non coding transcript exon variant snp 1
rs387906735 1.000 0.071 MT 608 non coding transcript exon variant snp 1
rs121434462 MT 12315 non coding transcript exon variant snp 1
rs387906736 MT 5556 non coding transcript exon variant snp 1
rs121434456 MT 10438 non coding transcript exon variant snp 1