Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs63750781
rs63750781
5 0.878 0.143 3 37004444 stop gained C/G,T snp 4.0E-06 0.700 19 1996 2017
dbSNP: rs63750217
rs63750217
7 0.821 0.143 3 37048955 missense variant G/A,C snp 0.700 16 1997 2017
dbSNP: rs63751711
rs63751711
4 0.923 0.143 3 37012099 missense variant G/A,T snp 0.700 16 1996 2017
dbSNP: rs63750206
rs63750206
6 0.878 0.179 3 36996701 missense variant G/A,T snp 0.700 15 1996 2017
dbSNP: rs63750767
rs63750767
3 1.000 0.143 2 47806607 stop gained A/ATCAAAAGGGACATAGAAAA in-del 0.700 15 2005 2017
dbSNP: rs267608087
rs267608087
4 0.923 0.143 2 47803508 frameshift variant C/CC,CCC in-del 0.700 14 1997 2017
dbSNP: rs28929483
rs28929483
5 0.878 0.143 2 47475130 missense variant C/A,G,T snp 0.700 14 1994 2017
dbSNP: rs587782425
rs587782425
4 0.923 0.143 2 47803501 frameshift variant C/CC in-del 0.700 14 1997 2017
dbSNP: rs63750828
rs63750828
5 0.878 0.143 2 47416351 missense variant G/A snp 0.700 13 2003 2017
dbSNP: rs63751466
rs63751466
5 0.878 0.179 7 5977629 stop gained G/A,T snp 2.7E-05 0.700 12 1986 2017
dbSNP: rs267607759
rs267607759
2 1.000 0.143 3 37011818 splice acceptor variant A/C,G snp 0.700 11 1996 2017
dbSNP: rs267607906
rs267607906
3 1.000 0.143 3 37050576 stop gained A/T snp 0.700 11 1996 2017
dbSNP: rs267608094
rs267608094
4 0.923 0.143 2 47806641 stop gained C/A,T snp 4.1E-06; 4.1E-06 0.700 11 2005 2017
dbSNP: rs63749831
rs63749831
4 0.923 0.143 2 47475051 inframe deletion CAAT/C in-del 4.0E-06 0.700 11 1994 2017
dbSNP: rs63750393
rs63750393
4 0.923 0.143 2 47471008 frameshift variant AGA/A in-del 0.700 11 2002 2017
dbSNP: rs63750871
rs63750871
5 0.878 0.179 7 6002590 stop gained G/A snp 4.0E-06 0.700 11 1995 2017
dbSNP: rs63750875
rs63750875
12 0.744 0.179 2 47475171 missense variant G/A,C snp 1.6E-05 3.2E-05 0.700 11 2003 2017
dbSNP: rs63751194
rs63751194
4 0.923 0.143 3 37017508 stop gained C/A,T snp 4.0E-06 0.700 11 2001 2017
dbSNP: rs63751657
rs63751657
4 0.923 0.143 3 37042331 missense variant G/A,C snp 0.700 11 2004 2017
dbSNP: rs193922376
rs193922376
4 0.923 0.143 2 47414421 splice region variant A/G,T snp 3.3E-05 0.700 10 1994 2017
dbSNP: rs587780059
rs587780059
4 0.923 0.143 7 6009018 start lost A/C,G,T snp 4.0E-06; 4.0E-06; 8.0E-06 0.700 10 2001 2017
dbSNP: rs63750250
rs63750250
4 0.923 0.143 7 5986933 frameshift variant A/AT in-del 1.6E-05 6.4E-05 0.700 10 2005 2017
dbSNP: rs63750617
rs63750617
5 0.878 0.143 2 47803473 missense variant C/G,T snp 4.0E-06; 9.5E-05 0.700 10 2004 2017
dbSNP: rs63751319
rs63751319
4 0.923 0.143 2 47806490 frameshift variant AGGAGACT/A in-del 0.700 10 2005 2017
dbSNP: rs63751618
rs63751618
4 0.923 0.143 2 47480870 frameshift variant GAG/G in-del 0.700 10 1996 2017