Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1057519793
rs1057519793
1 1.000 0.036 5 177095551 missense variant T/A snp 0.700 2 2009 2014
dbSNP: rs1057519696
rs1057519696
ALK
1 1.000 0.036 2 29214054 missense variant C/T snp 0.700 1 2012 2012
dbSNP: rs1057519792
rs1057519792
1 1.000 0.036 5 177095415 missense variant C/A,G snp 0.700 1 2014 2014
dbSNP: rs80357989
rs80357989
4 0.923 0.179 17 43094680 frameshift variant T/TGTAATGA in-del 0.700 1 2015 2015
dbSNP: rs121913529
rs121913529
70 0.559 0.393 12 25245350 missense variant C/A,G,T snp 4.0E-06 0.030 1.000 3 2011 2013
dbSNP: rs121918453
rs121918453
11 0.756 0.286 12 112450394 missense variant G/A,C,T snp 0.010 1.000 1 2006 2006
dbSNP: rs28934576
rs28934576
64 0.563 0.536 17 7673802 missense variant C/A,G,T snp 4.0E-06; 1.6E-05 0.010 1.000 1 2011 2011
dbSNP: rs376562429
rs376562429
3 0.923 0.036 7 100855814 missense variant C/G snp 4.4E-05 0.010 1.000 1 2005 2005
dbSNP: rs751531281
rs751531281
3 0.923 0.036 7 100855812 frameshift variant AGTCTGTGCTTGATGTCTTCGGGGCCG/A in-del 4.0E-06 3.2E-05 0.010 1.000 1 2005 2005
dbSNP: rs770020203
rs770020203
1 1.000 0.036 12 25227304 missense variant T/C snp 4.0E-06 0.010 1.000 1 2006 2006
dbSNP: rs774829510
rs774829510
1 1.000 0.036 9 21971046 missense variant C/T snp 0.010 1.000 1 1999 1999