Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs114251396
rs114251396
2 0.923 0.107 16 2089813 missense variant G/A snp 3.7E-03 4.0E-03 0.700 2 1999 2012
dbSNP: rs199476095
rs199476095
2 1.000 0.107 16 2089957 stop gained G/A,C snp 4.1E-06 0.700 1 1996 1996
dbSNP: rs115538130
rs115538130
2 0.923 0.107 16 2090179 missense variant G/A,T snp 9.3E-04; 4.2E-06 1.6E-03 0.700 1 2000 2000
dbSNP: rs199476102
rs199476102
1 1.000 0.107 16 2090309 stop gained C/T snp 0.700 1 2000 2000
dbSNP: rs1060499718
rs1060499718
1 1.000 0.107 16 2090418 frameshift variant AAC/A in-del 0.700 0
dbSNP: rs199476097
rs199476097
1 1.000 0.107 16 2090468 stop gained A/T snp 0.700 1 1996 1996
dbSNP: rs199476094
rs199476094
1 1.000 0.107 16 2090688 stop gained G/A snp 0.700 1 1995 1995
dbSNP: rs142768096
rs142768096
2 0.923 0.107 16 2090717 missense variant C/A,T snp 6.1E-05; 1.2E-04 1.6E-04; 1.3E-04 0.700 1 1998 1998
dbSNP: rs886040959
rs886040959
1 1.000 0.107 16 2090962 frameshift variant TAGTGAAGCGGCGCGGGCGGCCGCGCA/TTCACTAGCTT in-del 0.700 0
dbSNP: rs199476096
rs199476096
1 1.000 0.107 16 2091806 stop gained G/A snp 0.700 1 1996 1996
dbSNP: rs199476098
rs199476098
1 1.000 0.107 16 2091861 stop gained G/T snp 4.2E-06 0.700 1 1996 1996
dbSNP: rs369825780
rs369825780
1 1.000 0.107 16 2092181 synonymous variant G/A,C snp 1.8E-05 0.700 0
dbSNP: rs745912756
rs745912756
1 1.000 0.107 16 2093032 missense variant G/A snp 4.0E-06 0.700 0
dbSNP: rs781492044
rs781492044
2 0.923 0.107 16 2093828 missense variant C/T snp 2.9E-05 3.2E-05 0.700 1 2003 2003
dbSNP: rs79000340
rs79000340
2 0.923 0.107 16 2093954 missense variant C/A,G,T snp 9.8E-06; 4.9E-06; 2.2E-03 1.5E-03 0.700 1 2001 2001
dbSNP: rs1057516041
rs1057516041
1 1.000 0.107 16 2094127 stop gained C/A,T snp 9.4E-06 0.700 2 2015 2017
dbSNP: rs141946034
rs141946034
2 0.923 0.107 16 2094179 missense variant G/C snp 1.3E-03 9.2E-04 0.700 1 1997 1997
dbSNP: rs780009030
rs780009030
1 1.000 0.107 16 2097376 missense variant C/T snp 4.1E-06 0.700 0
dbSNP: rs1114167366
rs1114167366
1 1.000 0.107 16 2097725 splice donor variant CCA/C in-del 0.700 0
dbSNP: rs776463508
rs776463508
2 0.923 0.107 16 2097890 missense variant G/A,C,T snp 2.8E-05; 9.7E-05; 4.1E-06 0.700 1 2001 2001
dbSNP: rs371283948
rs371283948
2 0.923 0.107 16 2097912 missense variant C/T snp 8.1E-05 0.700 2 1999 2000
dbSNP: rs781263445
rs781263445
2 0.923 0.107 16 2097971 missense variant snp 4.4E-06 0.700 1 2003 2003
dbSNP: rs201780393
rs201780393
2 0.923 0.107 16 2099931 missense variant C/T snp 1.8E-05 6.4E-05 0.700 1 2001 2001
dbSNP: rs148812376
rs148812376
4 0.878 0.107 16 2099955 missense variant G/A snp 1.7E-04 4.8E-04 0.700 1 1993 1993
dbSNP: rs1057516202
rs1057516202
1 1.000 0.107 16 2100027 inframe deletion AGCT/A in-del 0.700 0