Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1057516202
rs1057516202
1 1.000 0.107 16 2100027 inframe deletion AGCT/A in-del 0.700 0
dbSNP: rs1057516206
rs1057516206
1 1.000 0.107 16 2111624 stop gained A/T snp 0.700 0
dbSNP: rs1060499699
rs1060499699
1 1.000 0.107 16 2117579 missense variant G/T snp 0.700 0
dbSNP: rs1060499702
rs1060499702
1 1.000 0.107 16 2108743 frameshift variant TG/T in-del 0.700 0
dbSNP: rs1060499704
rs1060499704
1 1.000 0.107 16 2100396 missense variant C/A snp 0.700 0
dbSNP: rs1060499718
rs1060499718
1 1.000 0.107 16 2090418 frameshift variant AAC/A in-del 0.700 0
dbSNP: rs1114167366
rs1114167366
1 1.000 0.107 16 2097725 splice donor variant CCA/C in-del 0.700 0
dbSNP: rs1114167370
rs1114167370
1 1.000 0.107 16 2118296 missense variant A/C snp 0.700 0
dbSNP: rs369825780
rs369825780
1 1.000 0.107 16 2092181 synonymous variant G/A,C snp 1.8E-05 0.700 0
dbSNP: rs539793378
rs539793378
1 1.000 0.107 16 2108868 missense variant G/A,T snp 8.8E-05 3.2E-05 0.700 0
dbSNP: rs745912756
rs745912756
1 1.000 0.107 16 2093032 missense variant G/A snp 4.0E-06 0.700 0
dbSNP: rs762003393
rs762003393
1 1.000 0.107 16 2105867 missense variant C/G,T snp 4.3E-06 0.700 0
dbSNP: rs780009030
rs780009030
1 1.000 0.107 16 2097376 missense variant C/T snp 4.1E-06 0.700 0
dbSNP: rs796052133
rs796052133
1 1.000 0.107 16 2118760 frameshift variant TG/T in-del 0.700 0
dbSNP: rs886040959
rs886040959
1 1.000 0.107 16 2090962 frameshift variant TAGTGAAGCGGCGCGGGCGGCCGCGCA/TTCACTAGCTT in-del 0.700 0
dbSNP: rs199476099
rs199476099
2 0.923 0.107 16 2118021 missense variant C/A,T snp 2.5E-03; 1.1E-05 4.8E-03 0.800 1 1999 1999
dbSNP: rs1033550407
rs1033550407
2 0.923 0.107 16 2111442 missense variant G/A snp 0.700 1 2009 2009
dbSNP: rs115538130
rs115538130
2 0.923 0.107 16 2090179 missense variant G/A,T snp 9.3E-04; 4.2E-06 1.6E-03 0.700 1 2000 2000
dbSNP: rs139945204
rs139945204
2 0.923 0.107 16 2100465 missense variant T/A snp 9.9E-04 2.9E-03 0.700 1 2002 2002
dbSNP: rs139971481
rs139971481
2 0.923 0.107 16 2108418 missense variant G/A snp 2.3E-03 1.8E-03 0.700 1 2000 2000
dbSNP: rs140791671
rs140791671
2 0.923 0.107 16 2100044 missense variant C/T snp 4.6E-05 1.6E-04 0.700 1 2001 2001
dbSNP: rs141946034
rs141946034
2 0.923 0.107 16 2094179 missense variant G/C snp 1.3E-03 9.2E-04 0.700 1 1997 1997
dbSNP: rs142768096
rs142768096
2 0.923 0.107 16 2090717 missense variant C/A,T snp 6.1E-05; 1.2E-04 1.6E-04; 1.3E-04 0.700 1 1998 1998
dbSNP: rs143690392
rs143690392
2 0.923 0.107 16 2111149 missense variant G/A snp 2.6E-03 3.1E-03 0.700 1 2002 2002
dbSNP: rs148812376
rs148812376
4 0.878 0.107 16 2099955 missense variant G/A snp 1.7E-04 4.8E-04 0.700 1 1993 1993