Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs121917739
rs121917739
3 0.878 0.071 15 40718818 missense variant G/A snp 3.7E-04 1.8E-03 0.810 1.000 3 2000 2015
dbSNP: rs28897696
rs28897696
9 0.801 0.179 17 43063903 missense variant G/A,C,T snp 2.8E-05; 4.0E-06; 2.0E-05 3.2E-05 0.800 4 1994 2015
dbSNP: rs41293455
rs41293455
9 0.801 0.179 17 43082434 stop gained G/A,C snp 2.4E-05; 3.2E-05 3.2E-05; 3.2E-05 0.800 4 1995 2015
dbSNP: rs80357389
rs80357389
6 0.846 0.179 17 43076488 missense variant C/A,G,T snp 4.0E-06 0.800 2 2007 2015
dbSNP: rs28897672
rs28897672
12 0.756 0.214 17 43106487 missense variant A/C,G,T snp 3.2E-05 0.800 1 2015 2015
dbSNP: rs55770810
rs55770810
10 0.769 0.250 17 43063931 missense variant G/A,T snp 2.4E-05; 8.0E-06 0.800 1 2015 2015
dbSNP: rs28904921
rs28904921
12 0.756 0.286 11 108329202 missense variant T/G snp 4.0E-05 6.4E-05 0.710 1.000 2 2004 2015
dbSNP: rs80357382
rs80357382
9 0.784 0.214 17 43106457 missense variant T/C snp 4.0E-06 0.710 1.000 2 2001 2015
dbSNP: rs118203998
rs118203998
8 0.821 0.357 16 23603471 stop gained G/C,T snp 1.6E-05; 4.0E-06 0.700 19 2007 2017
dbSNP: rs137853007
rs137853007
5 0.846 0.179 22 28725254 missense variant G/A,T snp 5.2E-05 3.2E-05 0.700 16 2001 2017
dbSNP: rs515726117
rs515726117
2 1.000 0.071 16 23603658 frameshift variant AC/A in-del 4.0E-06 0.700 13 2006 2017
dbSNP: rs587776428
rs587776428
2 1.000 0.071 16 23603515 frameshift variant GAG/G in-del 0.700 13 2006 2017
dbSNP: rs121908698
rs121908698
4 1.000 0.071 22 28725242 splice donor variant C/A,T snp 4.0E-06; 1.3E-04 2.2E-04 0.700 12 2003 2017
dbSNP: rs587776426
rs587776426
2 1.000 0.071 16 23603563 frameshift variant G/GT in-del 0.700 11 2006 2017
dbSNP: rs515726123
rs515726123
3 1.000 0.071 16 23636037 frameshift variant TCT/T in-del 0.700 10 2010 2017
dbSNP: rs515726126
rs515726126
2 1.000 0.071 16 23635788 frameshift variant A/AA in-del 0.700 10 2012 2017
dbSNP: rs587780024
rs587780024
3 0.923 0.179 2 214730457 frameshift variant T/TCATACTTTTCTTCCTGTTCA in-del 6.4E-05 3.2E-05 0.700 10 2007 2017
dbSNP: rs180177083
rs180177083
3 0.923 0.179 16 23637865 stop gained G/A,T snp 8.0E-06; 4.0E-06 0.700 9 2011 2017
dbSNP: rs180177100
rs180177100
6 0.846 0.357 16 23635306 stop gained G/A snp 8.0E-06 0.700 9 2011 2017
dbSNP: rs587782401
rs587782401
5 0.846 0.179 22 28734401 splice donor variant A/G,T snp 4.0E-06; 6.8E-05 3.8E-04 0.700 9 2012 2018
dbSNP: rs180177110
rs180177110
2 1.000 0.071 16 23629897 stop gained G/A,T snp 2.4E-05 0.700 8 2007 2017
dbSNP: rs180177127
rs180177127
2 1.000 0.071 16 23622982 frameshift variant C/CA in-del 0.700 8 2007 2017
dbSNP: rs587780021
rs587780021
4 0.878 0.179 2 214745842 stop gained G/A snp 2.4E-05 3.2E-05 0.700 8 2012 2017
dbSNP: rs180177102
rs180177102
3 1.000 0.071 16 23634954 frameshift variant CA/C in-del 1.8E-04 9.6E-05 0.700 7 2007 2017
dbSNP: rs180177111
rs180177111
5 0.878 0.071 16 23629831 stop gained G/A snp 4.0E-06 0.700 7 2008 2017