Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs104894229
rs104894229
31 0.634 0.500 11 534289 missense variant C/A,G,T snp 0.900 1.000 31 2005 2017
dbSNP: rs104894230
rs104894230
42 0.615 0.464 11 534288 missense variant C/A,G,T snp 0.830 1.000 17 1990 2017
dbSNP: rs104894228
rs104894228
26 0.662 0.500 11 534286 missense variant C/A,G,T snp 0.830 1.000 9 2006 2017
dbSNP: rs104894227
rs104894227
2 0.923 0.107 11 533553 missense variant T/C snp 0.820 1.000 5 2006 2013
dbSNP: rs104894226
rs104894226
19 0.692 0.464 11 534285 missense variant C/A,G,T snp 0.810 1.000 3 2005 2017
dbSNP: rs121917757
rs121917757
2 0.923 0.107 11 534259 stop gained G/A,T snp 1.2E-05 0.810 1.000 2 2008 2015
dbSNP: rs121917758
rs121917758
2 0.923 0.107 11 533883 missense variant G/A snp 0.800 8 2006 2014
dbSNP: rs121917759
rs121917759
7 0.801 0.321 11 533466 missense variant G/A snp 0.800 4 2007 2013
dbSNP: rs104894231
rs104894231
8 0.784 0.321 11 533467 missense variant C/G,T snp 0.800 1 2007 2007
dbSNP: rs727503094
rs727503094
6 0.821 0.143 11 534287 stop gained GC/TA,AG,AT,TT multinucleotide-polymorphism 0.740 1.000 6 2006 2017
dbSNP: rs727503093
rs727503093
3 0.878 0.143 11 533881 missense variant C/T snp 0.700 10 1982 2013
dbSNP: rs121917756
rs121917756
2 0.923 0.107 11 533869 missense variant C/T snp 0.700 1 2008 2008
dbSNP: rs398122808
rs398122808
1 1.000 0.071 11 534210 splice donor variant A/ACCT in-del 0.700 1 2010 2010
dbSNP: rs398122809
rs398122809
1 1.000 0.071 11 534212 inframe insertion C/CTCT in-del 0.700 1 2010 2010
dbSNP: rs587777239
rs587777239
1 1.000 0.071 11 533869 inframe insertion C/CGTCCCGCATGGCGCTGTACTC in-del 0.700 1 2013 2013
dbSNP: rs727504747
rs727504747
1 1.000 0.071 11 533880 missense variant GC/AG multinucleotide-polymorphism 0.700 1 2013 2013
dbSNP: rs730880460
rs730880460
1 1.000 0.071 11 533877 missense variant C/A,T snp 0.010 1.000 1 2018 2018
dbSNP: rs754945616
rs754945616
1 1.000 0.071 5 87268639 missense variant G/T snp 4.2E-06 0.010 1.000 1 2018 2018
dbSNP: rs774248606
rs774248606
1 1.000 0.071 5 87268482 missense variant G/A snp 6.3E-06 0.010 1.000 1 2014 2014