Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs112445441
rs112445441
17 0.699 0.286 12 25245347 missense variant snp 0.700 0
dbSNP: rs121913530
rs121913530
39 0.615 0.321 12 25245351 missense variant C/A,G,T snp 0.700 0
dbSNP: rs28933379
rs28933379
APC
3 0.923 0.071 5 112838953 missense variant G/A snp 0.700 0
dbSNP: rs372481703
rs372481703
APC
2 0.923 0.071 5 112839106 missense variant G/A snp 1.6E-05 3.2E-05 0.700 0
dbSNP: rs121912469
rs121912469
3 0.923 0.071 5 132489457 missense variant T/A snp 0.700 1 1998 1998
dbSNP: rs367807476
rs367807476
1 1.000 0.071 19 1223035 missense variant C/T snp 9.2E-06 0.700 1 1998 1998
dbSNP: rs121912470
rs121912470
3 0.878 0.107 5 132489448 missense variant A/G snp 0.700 1 1999 1999
dbSNP: rs768678989
rs768678989
MET
2 0.923 0.071 7 116771932 stop gained C/T snp 2.8E-05 0.010 1.000 1 2000 2000
dbSNP: rs121918505
rs121918505
5 0.846 0.143 10 121520119 missense variant A/G snp 0.010 1.000 1 2001 2001
dbSNP: rs121909776
rs121909776
3 0.923 0.071 2 201187798 missense variant T/C snp 1.2E-04 9.6E-05 0.700 1 2002 2002
dbSNP: rs121913528
rs121913528
4 0.878 0.071 12 25227349 missense variant C/A,T snp 0.700 2 1992 2003
dbSNP: rs104894361
rs104894361
5 0.846 0.214 12 25245370 missense variant T/A,C,G snp 4.0E-06 0.700 1 2003 2003
dbSNP: rs4444903
rs4444903
EGF
16 0.707 0.179 4 109912954 5 prime UTR variant A/G snp 0.50 0.010 1.000 1 2005 2005
dbSNP: rs753529000
rs753529000
2 0.923 0.071 6 36684465 missense variant C/T snp 4.0E-05 6.4E-05 0.010 1.000 1 2005 2005
dbSNP: rs1042028
rs1042028
20 0.685 0.321 16 28606193 missense variant C/T snp 0.22 0.31 0.010 1.000 1 2006 2006
dbSNP: rs1047972
rs1047972
15 0.707 0.214 20 56386407 missense variant T/C snp 0.85 0.84 0.010 1.000 1 2006 2006
dbSNP: rs9282861
rs9282861
20 0.685 0.321 16 28606193 missense variant C/T snp 0.010 1.000 1 2006 2006
dbSNP: rs1051266
rs1051266
28 0.647 0.500 21 45537880 missense variant T/C,G snp 0.55; 4.4E-06 0.51 0.020 1.000 2 2007 2007
dbSNP: rs28933369
rs28933369
5 0.878 0.071 17 39724744 missense variant G/A snp 0.700 2 2004 2007
dbSNP: rs1051740
rs1051740
29 0.647 0.429 1 225831932 missense variant T/C snp 0.32 0.28 0.010 1.000 1 2007 2007
dbSNP: rs1864169
rs1864169
2 0.923 0.071 14 81203689 intron variant G/T snp 0.77 0.010 1.000 1 2007 2007
dbSNP: rs768231616
rs768231616
3 0.878 0.107 15 74750069 frameshift variant CCT/C in-del 4.0E-06 0.010 1.000 1 2007 2007
dbSNP: rs1801282
rs1801282
77 0.543 0.679 3 12351626 missense variant C/G snp 0.11 1.0E-01 0.020 1.000 2 2008 2008
dbSNP: rs1805192
rs1805192
75 0.545 0.679 3 12379739 missense variant C/G snp 0.020 1.000 2 2008 2008
dbSNP: rs28360071
rs28360071
5 0.821 0.143 5 83142293 intron variant GGATGAGGAAACTAACTCTCAGTGGTGTTTA/G in-del 0.48 0.010 1.000 1 2008 2008