Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs35705950
rs35705950
7 0.821 0.071 11 1219991 regulatory region variant G/A,T snp 2.6E-04; 7.7E-02 1.000 1.000 21 2011 2018
dbSNP: rs2736100
rs2736100
52 0.596 0.571 5 1286401 intron variant C/A snp 0.53 0.820 0.500 2 2008 2014
dbSNP: rs5743890
rs5743890
1 1.000 0.036 11 1304599 intron variant T/C snp 1.0E-01 0.810 1.000 1 2014 2014
dbSNP: rs17690703
rs17690703
5 0.878 0.107 17 45847931 intron variant C/T snp 0.16 0.800 1 2014 2014
dbSNP: rs5743894
rs5743894
1 1.000 0.036 11 1303542 intron variant T/A,C snp 0.12 0.800 1 2014 2014
dbSNP: rs149989682
rs149989682
4 0.878 0.071 16 2317763 missense variant T/A,C snp 2.3E-03 2.7E-03 0.700 16 2006 2014
dbSNP: rs876657633
rs876657633
1 1.000 0.036 16 2300001 splice donor variant GGCACCTT/GTGG in-del 0.700 3 2008 2014
dbSNP: rs111521887
rs111521887
1 1.000 0.036 11 1291476 intron variant C/G snp 0.12 0.700 1 2014 2014
dbSNP: rs111576740
rs111576740
2 0.923 0.036 5 1266537 splice acceptor variant T/C,G snp 0.700 1 1993 1993
dbSNP: rs121917737
rs121917737
1 1.000 0.036 10 79557264 missense variant C/A snp 0.700 1 2009 2009
dbSNP: rs121917738
rs121917738
1 1.000 0.036 10 79557363 missense variant A/G snp 0.700 1 2009 2009
dbSNP: rs121918666
rs121918666
2 0.923 0.036 5 1266524 missense variant C/T snp 8.2E-06 3.2E-05 0.700 1 1993 1993
dbSNP: rs146221660
rs146221660
2 0.923 0.036 20 63693248 missense variant G/A,T snp 2.8E-05; 4.0E-06 6.4E-05 0.700 1 2015 2015
dbSNP: rs199422268
rs199422268
2 0.923 0.036 3 169764963 non coding transcript exon variant C/T snp 0.700 1 1993 1993
dbSNP: rs199422289
rs199422289
1 1.000 0.036 5 1294893 stop gained G/A snp 0.700 1 1993 1993
dbSNP: rs199422290
rs199422290
1 1.000 0.036 5 1294878 frameshift variant AG/A in-del 0.700 1 1993 1993
dbSNP: rs199422291
rs199422291
1 1.000 0.036 5 1294456 missense variant C/T snp 0.700 1 1993 1993
dbSNP: rs199422293
rs199422293
1 1.000 0.036 5 1293430 missense variant G/A snp 0.700 1 1993 1993
dbSNP: rs199422294
rs199422294
4 0.878 0.071 5 1280216 missense variant C/T snp 0.700 1 1993 1993
dbSNP: rs199422300
rs199422300
2 0.923 0.036 5 1278687 frameshift variant GA/G in-del 0.700 1 1993 1993
dbSNP: rs199422308
rs199422308
1 1.000 0.036 5 1253547 3 prime UTR variant GGCCTCAGCCGGACACTCAGCCTTCAGCCGGACATGCAGGCCTCGGCCAAACACTCACTCAGGCCTCAGACTCCCAGCGGTGCGGGCCTGGGTGTGGGCCGCCCCTCCCTCCCTGGGACGTAGAGCCCGGCGTGACAGGGCTGCTGGTGTCTGCTCTCGGCCTGGCTGTGGGCGGGTG/G in-del 0.700 1 1993 1993
dbSNP: rs199422309
rs199422309
2 0.923 0.036 5 1294770 splice donor variant C/T snp 0.700 1 1993 1993
dbSNP: rs201540674
rs201540674
4 0.846 0.107 20 63695619 missense variant G/A snp 1.6E-04 6.4E-05 0.700 1 2015 2015
dbSNP: rs2076295
rs2076295
DSP
3 0.923 0.036 6 7562999 intron variant T/G snp 0.46 0.700 1 2018 2018
dbSNP: rs28673968
rs28673968
1 1.000 0.036 4 89655739 intron variant T/C snp 0.36 0.700 1 2018 2018