Variant | Gene | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||
---|---|---|---|---|---|---|---|---|---|---|
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | GeneticVariation | CLINVAR | ||||||
|
GCT | 0.700 | CausalMutation | CLINVAR | Detection of rarely identified multiple mutations in MECP2 gene do not contribute to enhanced severity in Rett syndrome. | 23696494 | 2013 |
|||
|
G | 0.700 | CausalMutation | CLINVAR | Detection of rarely identified multiple mutations in MECP2 gene do not contribute to enhanced severity in Rett syndrome. | 23696494 | 2013 |
|||
|
T | 0.700 | CausalMutation | CLINVAR | Detection of rarely identified multiple mutations in MECP2 gene do not contribute to enhanced severity in Rett syndrome. | 23696494 | 2013 |
|||
|
A | 0.700 | GeneticVariation | CLINVAR | Detection of rarely identified multiple mutations in MECP2 gene do not contribute to enhanced severity in Rett syndrome. | 23696494 | 2013 |
|||
|
CCTCAGCTTTTCGCTTCCTGCCGGGG | 0.700 | CausalMutation | CLINVAR | ||||||
|
CCACGG | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
TGCAAAGAGGAGAAGATGCCCAGAGGAGGCTCACT | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR |