Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs111401431
rs111401431
0.756 0.179 15 48468097 missense variant G/A snp
Weill-Marchesani Syndrome, Autosomal Dominant
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Musculoskeletal Diseases; Skin and Connective Tissue Diseases 0.700 1 2015 2015
dbSNP: rs1131692051
rs1131692051
1.000 0.143 15 48463209 inframe deletion AGTAGTTTCTGTAGCACAAACTTCT/A in-del
Weill-Marchesani Syndrome, Autosomal Dominant
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Musculoskeletal Diseases; Skin and Connective Tissue Diseases 0.700 1 2003 2003
dbSNP: rs113871094
rs113871094
0.769 0.179 15 48465820 stop gained G/A snp
Weill-Marchesani Syndrome, Autosomal Dominant
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Musculoskeletal Diseases; Skin and Connective Tissue Diseases 0.700 1 2015 2015
dbSNP: rs137854480
rs137854480
0.744 0.179 15 48537629 missense variant G/A snp
Weill-Marchesani Syndrome, Autosomal Dominant
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Musculoskeletal Diseases; Skin and Connective Tissue Diseases 0.700 1 2015 2015
dbSNP: rs193922228
rs193922228
0.769 0.179 15 48430736 missense variant A/G snp
Weill-Marchesani Syndrome, Autosomal Dominant
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Musculoskeletal Diseases; Skin and Connective Tissue Diseases 0.700 1 2015 2015
dbSNP: rs397515757
rs397515757
0.769 0.179 15 48515382 splice region variant C/T snp
Weill-Marchesani Syndrome, Autosomal Dominant
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Musculoskeletal Diseases; Skin and Connective Tissue Diseases 0.700 1 2015 2015
dbSNP: rs727503054
rs727503054
0.756 0.179 15 48420752 missense variant A/G,T snp 1.6E-05
Weill-Marchesani Syndrome, Autosomal Dominant
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Musculoskeletal Diseases; Skin and Connective Tissue Diseases 0.700 1 2015 2015