FAS, Fas cell surface death receptor, 355

N. diseases: 754; N. variants: 47
Disease: Autoimmune Lymphoproliferative Syndrome, Type IA ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs121913076
rs121913076 		0.925 0.120 10 89014163 missense variant A/C snv
CUI: C1866119
Disease: Autoimmune Lymphoproliferative Syndrome, Type IA
Autoimmune Lymphoproliferative Syndrome, Type IA 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs121913077
rs121913077 		1.000 0.120 10 89014259 stop gained C/T snv
CUI: C1866119
Disease: Autoimmune Lymphoproliferative Syndrome, Type IA
Autoimmune Lymphoproliferative Syndrome, Type IA 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs121913078
rs121913078 		0.925 0.120 10 89008915 missense variant C/T snv 4.0E-06
CUI: C1866119
Disease: Autoimmune Lymphoproliferative Syndrome, Type IA
Autoimmune Lymphoproliferative Syndrome, Type IA 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs121913080
rs121913080 		0.882 0.160 10 89014191 missense variant G/C snv
CUI: C1866119
Disease: Autoimmune Lymphoproliferative Syndrome, Type IA
Autoimmune Lymphoproliferative Syndrome, Type IA 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs121913081
rs121913081 		0.925 0.120 10 89014251 missense variant C/T snv
CUI: C1866119
Disease: Autoimmune Lymphoproliferative Syndrome, Type IA
Autoimmune Lymphoproliferative Syndrome, Type IA 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs121913085
rs121913085 		1.000 0.120 10 89014182 missense variant G/C snv
CUI: C1866119
Disease: Autoimmune Lymphoproliferative Syndrome, Type IA
Autoimmune Lymphoproliferative Syndrome, Type IA 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs121913086
rs121913086 		0.925 0.120 10 89014220 missense variant G/T snv
CUI: C1866119
Disease: Autoimmune Lymphoproliferative Syndrome, Type IA
Autoimmune Lymphoproliferative Syndrome, Type IA 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs267607122
rs267607122 		1.000 0.120 10 89012083 splice donor variant T/A;C snv
CUI: C1866119
Disease: Autoimmune Lymphoproliferative Syndrome, Type IA
Autoimmune Lymphoproliferative Syndrome, Type IA 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs28929498
rs28929498 		0.925 0.120 10 89014221 missense variant A/T snv
CUI: C1866119
Disease: Autoimmune Lymphoproliferative Syndrome, Type IA
Autoimmune Lymphoproliferative Syndrome, Type IA 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs606231361
rs606231361 		1.000 0.120 10 89007732 frameshift variant G/- delins
CUI: C1866119
Disease: Autoimmune Lymphoproliferative Syndrome, Type IA
Autoimmune Lymphoproliferative Syndrome, Type IA 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs606231362
rs606231362 		1.000 0.120 10 89007838 splice donor variant -/T delins
CUI: C1866119
Disease: Autoimmune Lymphoproliferative Syndrome, Type IA
Autoimmune Lymphoproliferative Syndrome, Type IA 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs606231363
rs606231363 		1.000 0.120 10 89011997 splice acceptor variant A/C snv
CUI: C1866119
Disease: Autoimmune Lymphoproliferative Syndrome, Type IA
Autoimmune Lymphoproliferative Syndrome, Type IA 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs606231364
rs606231364 		0.925 0.160 10 89003071 missense variant G/A snv
CUI: C1866119
Disease: Autoimmune Lymphoproliferative Syndrome, Type IA
Autoimmune Lymphoproliferative Syndrome, Type IA 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs606231365
rs606231365 		1.000 0.120 10 89014409 frameshift variant -/AAAATTCAAACTTCAGAAAT delins
CUI: C1866119
Disease: Autoimmune Lymphoproliferative Syndrome, Type IA
Autoimmune Lymphoproliferative Syndrome, Type IA 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs606231366
rs606231366 		1.000 0.120 10 89014134 frameshift variant -/T ins
CUI: C1866119
Disease: Autoimmune Lymphoproliferative Syndrome, Type IA
Autoimmune Lymphoproliferative Syndrome, Type IA 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0