NOS3, nitric oxide synthase 3, 4846

N. diseases: 706; N. variants: 39
Disease: Myocardial Infarction ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1799983
rs1799983 		0.430 0.880 7 150999023 missense variant T/A;G snv 0.75
CUI: C0027051
Disease: Myocardial Infarction
Myocardial Infarction 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.100 0.917 24 1998 2019
dbSNP: rs2070744
rs2070744 		0.608 0.680 7 150992991 intron variant C/T snv 0.70
CUI: C0027051
Disease: Myocardial Infarction
Myocardial Infarction 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.050 1.000 5 2013 2019
dbSNP: rs869109213
rs869109213 		0.790 0.200 7 150997269 intron variant GGGGGTGAGGAAGTCTAGACCTGCTGCG/A delins
CUI: C0027051
Disease: Myocardial Infarction
Myocardial Infarction 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.010 1.000 1 2019 2019