BARD1, BRCA1 associated RING domain 1, 580

N. diseases: 75; N. variants: 176
Disease: Neoplastic Syndromes, Hereditary ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs587780021
rs587780021 		0.851 0.200 2 214745842 stop gained G/A snv 2.4E-05 2.8E-05
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 6 2012 2017
dbSNP: rs750413473
rs750413473 		1.000 0.080 2 214728709 frameshift variant CA/- delins 3.2E-05 1.4E-05
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 6 2003 2015
dbSNP: rs587781707
rs587781707 		1.000 0.080 2 214752472 stop gained G/A;C snv 1.2E-05
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 4 2015 2016
dbSNP: rs587781948
rs587781948 		0.882 0.200 2 214730491 stop gained G/A snv 1.6E-05 3.5E-05
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 4 2013 2017
dbSNP: rs730881422
rs730881422 		1.000 0.080 2 214730416 stop gained G/A snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 4 2004 2017
dbSNP: rs587780024
rs587780024 		0.925 0.200 2 214730458 stop gained CTGTTCACATACTTTTCTTC/-;CTGTTCACATACTTTTCTTCCTGTTCACATACTTTTCTTC delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 2 2010 2015
dbSNP: rs587780033
rs587780033 		2 214781251 frameshift variant T/-;TT delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 2 2015 2016
dbSNP: rs730881411
rs730881411 		2 214781426 stop gained G/A;C snv 8.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 2 2016 2017
dbSNP: rs758972589
rs758972589 		2 214792327 stop gained G/A;T snv 8.0E-06 1.4E-05
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 2 2013 2016
dbSNP: rs1057517589
rs1057517589 		1.000 0.080 2 214797099 frameshift variant TC/- delins 7.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 1 2014 2014
dbSNP: rs1553619349
rs1553619349 		1.000 0.080 2 214767643 stop gained G/T snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 1 2008 2008
dbSNP: rs1553622178
rs1553622178 		2 214780662 stop gained -/T delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 1 2015 2015
dbSNP: rs587782681
rs587782681 		1.000 0.080 2 214780662 stop gained G/C snv 4.0E-06 2.1E-05
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 1 2015 2015
dbSNP: rs786202118
rs786202118 		2 214728742 stop gained C/T snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 1 2017 2017
dbSNP: rs786203811
rs786203811 		2 214728861 frameshift variant TG/- del
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 1 2011 2011
dbSNP: rs864622223
rs864622223 		2 214781246 frameshift variant TT/- delins 4.3E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 1 2015 2015
dbSNP: rs1060501288
rs1060501288 		2 214781066 stop gained C/A;G;T snv 4.2E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1064796026
rs1064796026 		2 214728946 frameshift variant -/T delins 7.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1213894295
rs1213894295 		2 214769242 stop gained C/T snv 4.0E-06 7.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1234033325
rs1234033325 		2 214745720 splice donor variant A/C snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1420243208
rs1420243208 		2 214781458 frameshift variant TT/- del
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1482641121
rs1482641121 		1.000 0.080 2 214780875 frameshift variant GA/- delins 4.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1553612164
rs1553612164 		2 214728867 stop gained G/A snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1553615092
rs1553615092 		2 214745723 frameshift variant T/- del
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1553615135
rs1553615135 		2 214745788 stop gained G/A snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0