RET, ret proto-oncogene, 5979

N. diseases: 607; N. variants: 162
Disease: Medullary carcinoma of thyroid ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs74799832
rs74799832 		0.662 0.280 10 43121968 missense variant T/C snv 4.0E-06
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.800 1.000 26 1996 2018
dbSNP: rs75076352
rs75076352 		0.689 0.240 10 43114500 missense variant T/A;C;G snv 1.2E-05
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.800 1.000 13 1995 2018
dbSNP: rs79658334
rs79658334 		0.662 0.360 10 43119548 missense variant G/A;C;T snv 1.2E-04; 4.3E-06
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.800 1.000 12 1997 2019
dbSNP: rs75996173
rs75996173 		0.716 0.240 10 43114501 missense variant G/A;C;T snv 4.0E-06; 4.0E-06
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.770 1.000 8 1995 2015
dbSNP: rs75234356
rs75234356 		0.716 0.240 10 43120144 missense variant T/G snv 1.2E-05 7.0E-06
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.760 1.000 7 1997 2019
dbSNP: rs77724903
rs77724903 		0.672 0.280 10 43118460 missense variant A/G;T snv 4.0E-06; 2.1E-03
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.750 0.833 6 2005 2015
dbSNP: rs77939446
rs77939446 		0.724 0.120 10 43113622 missense variant G/A;C;T snv 4.0E-06
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.740 1.000 5 1995 2009
dbSNP: rs77709286
rs77709286 		0.752 0.160 10 43114502 missense variant C/G snv 4.0E-06
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.730 1.000 6 2002 2017
dbSNP: rs377767404
rs377767404 		0.742 0.160 10 43114488 missense variant T/C snv
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.730 1.000 4 1999 2017
dbSNP: rs76262710
rs76262710 		0.724 0.280 10 43113648 missense variant T/A;C;G snv 4.0E-06; 4.0E-06
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.730 1.000 4 1997 2015
dbSNP: rs79781594
rs79781594 		0.732 0.160 10 43113649 missense variant G/A;C;T snv
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.730 1.000 4 1998 2015
dbSNP: rs377767429
rs377767429 		0.790 0.120 10 43120120 missense variant GC/TT mnv
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.720 1.000 4 2004 2017
dbSNP: rs77503355
rs77503355 		0.776 0.160 10 43113655 missense variant G/A;C;T snv
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.710 1.000 2 1997 2015
dbSNP: rs78014899
rs78014899 		0.742 0.160 10 43118392 missense variant G/A;C;T snv 8.0E-06
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.710 1.000 2 1997 2006
dbSNP: rs121913308
rs121913308 		0.827 0.120 10 43114492 missense variant A/C;G;T snv
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.700 1.000 1 2014 2014
dbSNP: rs121913309
rs121913309 		1.000 0.080 10 43120164 inframe deletion TGTTTATGAAGA/- delins
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.700 1.000 1 2014 2014
dbSNP: rs121913312
rs121913312 		1.000 0.080 10 43114494 inframe deletion GAGCTG/- del
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.700 1.000 1 2014 2014
dbSNP: rs121913313
rs121913313 		1.000 0.080 10 43113626 inframe deletion TTCCCTGAGGAGGAGAAGTGCTTCTGC/- delins
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.700 1.000 1 2014 2014
dbSNP: rs1799939
rs1799939 		0.658 0.280 10 43114671 missense variant G/A;C;T snv 0.21
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.070 0.857 7 2009 2017
dbSNP: rs75873440
rs75873440 		0.763 0.200 10 43112173 missense variant G/A;T snv 4.4E-05
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.070 1.000 7 2008 2017
dbSNP: rs77316810
rs77316810 		0.776 0.200 10 43113654 missense variant T/A;C;G snv
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.040 1.000 4 1995 2015
dbSNP: rs121913306
rs121913306 		0.851 0.120 10 43120119 missense variant AGC/TTT mnv
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.020 1.000 2 2011 2017
dbSNP: rs146646971
rs146646971 		0.807 0.120 10 43114598 missense variant G/C;T snv 2.4E-05
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.020 1.000 2 2016 2018
dbSNP: rs377767397
rs377767397 		0.790 0.280 10 43113628 missense variant G/A;C;T snv
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.020 1.000 2 2003 2015
dbSNP: rs377767398
rs377767398 		0.807 0.280 10 43113628 missense variant GC/AT;CT;TT mnv
CUI: C0238462
Disease: Medullary carcinoma of thyroid
Medullary carcinoma of thyroid 		Neoplasms; Endocrine System Diseases 0.020 1.000 2 2003 2015