Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs761004837
rs761004837
2 1.000 0.160 11 119089097 missense variant C/T snv 1.1E-04 4.9E-05 0.710 1.000 1 2008 2008
dbSNP: rs780020705
rs780020705
1 1.000 0.160 11 119092783 missense variant C/G snv 8.0E-06 0.010 1.000 1 2010 2010
dbSNP: rs974712040
rs974712040
1 1.000 0.160 11 119088651 missense variant C/T snv 0.710 1.000 1 2000 2000
dbSNP: rs1007859875
rs1007859875
1 1.000 0.160 11 119092137 missense variant G/A snv 4.0E-06 1.4E-05 0.700 0
dbSNP: rs118204097
rs118204097
1 1.000 0.160 11 119090230 stop gained C/T snv 0.700 0
dbSNP: rs118204103
rs118204103
1 1.000 0.160 11 119088298 missense variant G/A snv 0.700 0
dbSNP: rs118204104
rs118204104
1 1.000 0.160 11 119088638 missense variant G/A snv 7.0E-06 0.700 0
dbSNP: rs118204105
rs118204105
1 1.000 0.160 11 119088647 missense variant C/A snv 0.700 0
dbSNP: rs118204106
rs118204106
1 1.000 0.160 11 119089084 missense variant G/T snv 7.0E-06 0.700 0
dbSNP: rs118204108
rs118204108
1 1.000 0.160 11 119091444 missense variant T/G snv 0.700 0
dbSNP: rs118204110
rs118204110
1 1.000 0.160 11 119092419 stop gained G/A snv 0.700 0
dbSNP: rs118204111
rs118204111
1 1.000 0.160 11 119092491 missense variant T/C snv 0.700 0
dbSNP: rs118204112
rs118204112
1 1.000 0.160 11 119092500 missense variant G/A snv 0.700 0
dbSNP: rs118204113
rs118204113
1 1.000 0.160 11 119092506 missense variant G/A snv 8.0E-06 1.4E-05 0.700 0
dbSNP: rs118204114
rs118204114
1 1.000 0.160 11 119092507 missense variant C/T snv 4.0E-06 0.700 0
dbSNP: rs118204115
rs118204115
1 1.000 0.160 11 119092518 missense variant C/A;G snv 0.700 0
dbSNP: rs118204116
rs118204116
1 1.000 0.160 11 119092159 missense variant G/A;C snv 0.700 0
dbSNP: rs118204119
rs118204119
1 1.000 0.160 11 119089248 missense variant T/C snv 0.700 0
dbSNP: rs118204120
rs118204120
1 1.000 0.160 11 119090212 stop gained C/T snv 0.700 0
dbSNP: rs1334178100
rs1334178100
1 1.000 0.160 11 119092768 missense variant G/A snv 7.0E-06 0.700 0
dbSNP: rs1555206128
rs1555206128
1 1.000 0.160 11 119092417 inframe deletion AGTGCGAGCCAAGGACCAGGACATCTTGGA/- delins 0.700 0
dbSNP: rs1555206402
rs1555206402
26 0.790 0.320 11 119093274 stop lost GCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT/- delins 0.700 0
dbSNP: rs1565754285
rs1565754285
1 1.000 0.160 11 119089094 frameshift variant C/- delins 0.700 0
dbSNP: rs1565754296
rs1565754296
1 1.000 0.160 11 119089098 frameshift variant -/G delins 0.700 0
dbSNP: rs1565754452
rs1565754452
1 1.000 0.160 11 119089216 splice acceptor variant G/A snv 0.700 0