Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs10173538
rs10173538
5 2 159712765 intron variant C/G;T snv 0.700 1.000 1 2016 2016
dbSNP: rs1036207
rs1036207
3 1.000 0.080 5 142119476 intron variant A/G;T snv 0.700 1.000 1 2016 2016
dbSNP: rs10409243
rs10409243
6 19 10222312 3 prime UTR variant C/A;G;T snv 0.700 1.000 1 2016 2016
dbSNP: rs10795656
rs10795656
4 1.000 0.080 10 8553876 intergenic variant G/A;T snv 0.700 1.000 1 2016 2016
dbSNP: rs11127153
rs11127153
2 2 28463094 intron variant T/A;C snv 0.700 1.000 1 2016 2016
dbSNP: rs11204682
rs11204682
4 1 150623061 intron variant G/A;T snv 0.700 1.000 1 2016 2016
dbSNP: rs112505971
rs112505971
13 10 27068541 intron variant A/C;G snv 0.700 1.000 1 2019 2019
dbSNP: rs11353326
rs11353326
2 3 48941172 intron variant AAAAA/-;A;AA;AAA;AAAA;AAAAAA;AAAAAAA delins 0.700 1.000 1 2016 2016
dbSNP: rs113721499
rs113721499
1 6 31261530 intergenic variant C/T snv 0.700 1.000 1 2018 2018
dbSNP: rs11428934
rs11428934
4 19 48640988 intron variant -/G ins 0.700 1.000 1 2016 2016
dbSNP: rs1144700
rs1144700
5 6 16744456 intron variant C/G;T snv 0.700 1.000 1 2016 2016
dbSNP: rs11556924
rs11556924
21 0.752 0.240 7 130023656 missense variant C/A;T snv 4.0E-06; 0.28 0.700 1.000 1 2016 2016
dbSNP: rs11734460
rs11734460
4 4 711285 intron variant C/A;T snv 0.700 1.000 1 2016 2016
dbSNP: rs11741826
rs11741826
3 5 69294573 intron variant G/A;C snv 0.700 1.000 1 2016 2016
dbSNP: rs12151289
rs12151289
3 19 33260946 intergenic variant G/A;C;T snv 0.700 1.000 1 2016 2016
dbSNP: rs12545733
rs12545733
2 8 23099490 intron variant T/A;C snv 0.700 1.000 1 2016 2016
dbSNP: rs12593998
rs12593998
2 15 50766432 upstream gene variant A/C;G snv 0.700 1.000 1 2016 2016
dbSNP: rs12600856
rs12600856
5 17 40007042 intergenic variant T/C;G snv 0.700 1.000 1 2016 2016
dbSNP: rs12762973
rs12762973
1 10 914821 intron variant C/A;G snv 0.700 1.000 1 2016 2016
dbSNP: rs12968338
rs12968338
2 18 63584740 upstream gene variant C/G;T snv 0.700 1.000 1 2016 2016
dbSNP: rs13056815
rs13056815
2 22 31272264 intron variant G/A;C snv 0.700 1.000 1 2016 2016
dbSNP: rs139707092
rs139707092
5 2 168850753 intron variant TCTCTGGAAT/-;TCTCTGGAATTCTCTGGAAT delins 0.700 1.000 1 2016 2016
dbSNP: rs140948517
rs140948517
2 7 75857462 intron variant TT/-;T;TTT;TTTT;TTTTTTTTTTTT delins 0.700 1.000 1 2016 2016
dbSNP: rs14408
rs14408
4 11 308314 missense variant T/C;G snv 0.53 0.700 1.000 1 2016 2016
dbSNP: rs145013566
rs145013566
5 2 218297998 intron variant -/C ins 0.700 1.000 1 2016 2016