Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1047075022
rs1047075022
1 1.000 0.120 16 56506119 splice donor variant C/T snv 4.0E-06 7.0E-06 0.700 0
dbSNP: rs1166717771
rs1166717771
1 1.000 0.120 16 56485680 stop gained C/A snv 0.700 0
dbSNP: rs137854887
rs137854887
1 1.000 0.120 16 56510923 splice acceptor variant T/C snv 4.0E-06 0.700 0
dbSNP: rs1555520220
rs1555520220
1 1.000 0.120 16 56485611 stop gained G/A snv 0.700 0
dbSNP: rs1555520256
rs1555520256
1 1.000 0.120 16 56485739 splice acceptor variant C/T snv 0.700 0
dbSNP: rs1555521489
rs1555521489
1 1.000 0.120 16 56497742 splice donor variant C/T snv 0.700 0
dbSNP: rs1555522000
rs1555522000
1 1.000 0.120 16 56501498 splice acceptor variant C/A snv 0.700 0
dbSNP: rs1555522252
rs1555522252
1 1.000 0.120 16 56502693 frameshift variant -/GA delins 0.700 0
dbSNP: rs1555523964
rs1555523964
1 1.000 0.120 16 56514455 frameshift variant CTCTGTAGAACAAATCCGAA/- del 0.700 0
dbSNP: rs1555524593
rs1555524593
1 1.000 0.120 16 56519808 frameshift variant C/- delins 0.700 0
dbSNP: rs193922711
rs193922711
2 0.925 0.120 16 56497770 frameshift variant A/- delins 4.0E-06 0.700 0
dbSNP: rs4784677
rs4784677
1 1.000 0.120 16 56514589 missense variant C/T snv 0.99 1.00 0.700 0
dbSNP: rs587777824
rs587777824
1 1.000 0.120 16 56502673 frameshift variant T/- delins 0.700 0
dbSNP: rs587777825
rs587777825
1 1.000 0.120 16 56514681 splice acceptor variant C/G snv 0.700 0
dbSNP: rs745951028
rs745951028
1 1.000 0.120 16 56485697 frameshift variant TTAAGGT/- del 1.4E-05 0.700 0
dbSNP: rs746171104
rs746171104
1 1.000 0.120 16 56502672 splice donor variant C/- del 8.0E-06 0.700 0
dbSNP: rs767373822
rs767373822
2 0.925 0.120 16 56510871 missense variant A/G;T snv 1.2E-05 0.700 0
dbSNP: rs773862084
rs773862084
3 0.882 0.120 16 56510858 splice donor variant C/A snv 9.9E-05 3.5E-05 0.700 0
dbSNP: rs777234811
rs777234811
1 1.000 0.120 16 56502457 splice acceptor variant C/A snv 4.0E-06 0.700 0
dbSNP: rs878962682
rs878962682
1 1.000 0.120 16 56502458 splice acceptor variant T/C;G snv 4.0E-06 0.700 0
dbSNP: rs121908179
rs121908179
5 0.827 0.120 16 56514487 missense variant T/G snv 4.4E-05 2.8E-05 0.800 1.000 11 2001 2014
dbSNP: rs121908174
rs121908174
2 0.925 0.120 16 56514574 missense variant A/C snv 4.0E-06 0.800 1.000 10 2001 2017
dbSNP: rs121908178
rs121908178
1 1.000 0.120 16 56502454 missense variant G/A;C snv 1.6E-05; 4.0E-06 0.700 1.000 8 2001 2011
dbSNP: rs121908181
rs121908181
1 1.000 0.120 16 56511214 missense variant C/A snv 0.800 1.000 8 2001 2011
dbSNP: rs138043021
rs138043021
4 0.851 0.120 16 56496982 missense variant C/G;T snv 1.2E-04; 2.0E-05 0.700 1.000 8 2001 2017