Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1566903283
rs1566903283
2 0.925 0.160 15 48463219 coding sequence variant -/CACAAACTTCTTCTCATATCTAGAAGGGAG delins 0.700 0
dbSNP: rs1555395483
rs1555395483
2 0.925 0.160 15 48441828 inframe deletion GACACACTC/- delins 0.700 1.000 6 1973 2007
dbSNP: rs1566896070
rs1566896070
2 0.925 0.160 15 48437016 inframe deletion CATCTGTATTGATGCACTGTCCATGTTTAC/- delins 0.700 1.000 4 2006 2009
dbSNP: rs730880147
rs730880147
1 1.000 16 15726938 inframe deletion CTT/- delins 4.8E-05 1.4E-05 0.700 1.000 1 2019 2019
dbSNP: rs730880097
rs730880097
2 0.925 0.160 15 48644769 start lost T/A;C;G snv 0.700 1.000 5 1973 2017
dbSNP: rs886039072
rs886039072
2 0.925 0.160 15 48644767 start lost C/A;T snv 0.700 1.000 3 1973 2016
dbSNP: rs1555459260
rs1555459260
2 0.925 0.040 16 15838252 start lost T/C snv 0.700 0
dbSNP: rs397515757
rs397515757
10 0.752 0.200 15 48515382 splice region variant C/T snv 0.700 1.000 6 1999 2015
dbSNP: rs1445085747
rs1445085747
2 0.925 0.160 15 48508577 splice region variant C/T snv 4.0E-06 0.700 1.000 3 2000 2009
dbSNP: rs193922219
rs193922219
9 0.763 0.280 15 48446701 splice region variant C/A;T snv 0.700 1.000 3 1995 2009
dbSNP: rs1566909762
rs1566909762
2 0.925 0.160 15 48488112 splice region variant C/- delins 0.700 1.000 2 2007 2009
dbSNP: rs193922204
rs193922204
9 0.763 0.200 15 48468542 splice region variant C/T snv 4.0E-06 7.0E-06 0.700 1.000 2 2001 2009
dbSNP: rs778966916
rs778966916
2 0.925 0.160 15 48468107 splice region variant T/C;G snv 8.0E-06 0.700 1.000 2 2015 2015
dbSNP: rs193922243
rs193922243
2 0.925 0.160 15 48412564 splice region variant C/A;T snv 0.700 1.000 1 2017 2017
dbSNP: rs1555395742
rs1555395742
3 0.882 0.160 15 48445370 splice region variant A/G snv 0.700 0
dbSNP: rs1566894334
rs1566894334
2 0.925 0.160 15 48430805 splice region variant G/C snv 0.700 0
dbSNP: rs1566898741
rs1566898741
2 0.925 0.160 15 48446700 splice region variant A/C snv 0.700 0
dbSNP: rs1566902515
rs1566902515
2 0.925 0.160 15 48460241 splice region variant C/G snv 0.700 0
dbSNP: rs193922209
rs193922209
2 0.925 0.160 15 48467933 splice region variant C/A;G snv 0.700 0
dbSNP: rs201854371
rs201854371
2 0.925 0.160 15 48613007 splice region variant T/C;G snv 8.0E-06 0.700 0
dbSNP: rs745672741
rs745672741
2 1.000 15 67165247 splice region variant G/A;C snv 0.700 0
dbSNP: rs1553631693
rs1553631693
1 1.000 3 30688383 splice acceptor variant G/A snv 0.700 1.000 4 2006 2010
dbSNP: rs1555394585
rs1555394585
2 0.925 0.160 15 48427775 splice acceptor variant T/A snv 0.700 1.000 4 2002 2009
dbSNP: rs1555400077
rs1555400077
2 0.925 0.160 15 48510170 splice acceptor variant C/T snv 0.700 1.000 4 2007 2016
dbSNP: rs1566898144
rs1566898144
2 0.925 0.160 15 48444661 splice acceptor variant C/G snv 0.700 1.000 4 2005 2010