CP, ceruloplasmin, 1356

N. diseases: 283; N. variants: 64
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs386134124
rs386134124
1.000 0.080 3 149210187 missense variant G/A;C;T snv 4.0E-06; 4.0E-06
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.710 1.000 1 2002 2002
dbSNP: rs776936158
rs776936158
1.000 0.080 3 149186649 missense variant C/T snv 1.6E-05 2.1E-05
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 1.000 4 2002 2017
dbSNP: rs1553759167
rs1553759167
1.000 0.080 3 149185283 splice acceptor variant TGGGGAATAATCCCATTCCACCTCCACTGCTGCGATATAGTATGTCCTCTCTCCCAGGTAGAAGGTGGAATCCTCAGACTGCCGCCTGCATTGGTTCACAGTATATTTTTGCTTCATGCCGCCTGTGTAATGATCAGTTGTAAGGCATTCAACATTAAAAGTCCCTGGAGTGGTAAATAAGAAAACATGTCACTTCTTTGCTAGTGCCCTCTGGGGCTCTCCACCTTCCTCAGAATTA/- del
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 1.000 1 2015 2015
dbSNP: rs1553759338
rs1553759338
1.000 0.080 3 149186168 splice acceptor variant GAAAAGTTTAGGTGCAGAATATTTATGGGAGTCATTCCCCTTCTAGTCTGATTTTCCAGCTATCTTTAAAAGGACCATAATCTAAAAAGGGATCATCTTGAGGAGCCTATGGAAGTGGAGAAAACCACACCATGTTCTTTTACTCCACATTGTCCTCAGTAACTAGGAAACAGACCTATCTGGTACATACTTCAGCTGATAGTGGCCTAGACTTGCTCTTTCAAAGATAGGAAGGGCACTTCAGAGGCTTGGGGAAGGGATAAGTTTATCACCCAACACATTCTGCTACAGGATTTTAAACCAAAACTACACAAATCCATCCAATAGAGACTTGGCTTTAAGTAAATATACCCTCTGTGTCAGGCCACATGTGGAGCGTAAGACTTGTTTGAGGGAAGAGGTTTGCTGTGTCTCTCCGTTCTCCTCTCCACAGATATGTGTTTCCTGAAAAGTATATTCCATGTACATCGGCCTCATTTCCGGCGCTGAATAAGTACCACACGACCGAATCTCCTTTGCACATAGTGAGACCCGGCTGATTCCCATACATGAATCCATTCATGGCTGTAAAAGTTGGGAAATAACATTTTGGAAGTGGTTTAGATTCTACTACATGACAACCTCACAGACTTTCCAGGACCAACTTTGTTTTTTTAATTTTTAAAAGACCTATTCAGGCTTGCCCACGCTTTATGTGTCAGGAGTATCCTTGCAACTCCTTGTGGTTCCTGGCATTTCAGAGCAGCCGCTGGCTGAAAGGAGCAGAGCTGAATGCATAGTTCTTGTTCTATGCTAGTGTCCCTAGCAACCTGGGAATCCCACTGCTCTTCCTGGCTAAAACAATGATTCTGTTATT/- delins
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 1.000 1 2016 2016
dbSNP: rs34394958
rs34394958
1.000 0.080 3 149177867 missense variant A/C;G snv 3.3E-02
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 1.000 1 2002 2002
dbSNP: rs386134125
rs386134125
1.000 0.080 3 149209342 missense variant A/G snv
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 1.000 1 2004 2004
dbSNP: rs386134133
rs386134133
1.000 0.080 3 149177896 missense variant C/T snv
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 1.000 1 2006 2006
dbSNP: rs386134147
rs386134147
1.000 0.080 3 149186531 frameshift variant G/- delins
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 1.000 1 2006 2006
dbSNP: rs386134155
rs386134155
1.000 0.080 3 149209349 stop gained G/A snv 8.0E-06 7.0E-06
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 1.000 1 2006 2006
dbSNP: rs1064797073
rs1064797073
1.000 0.080 3 149198401 missense variant C/A snv
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1135401784
rs1135401784
0.925 0.120 3 149178537 missense variant A/G snv
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 0
dbSNP: rs121909579
rs121909579
1.000 0.080 3 149179587 stop gained C/T snv 4.0E-06
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 0
dbSNP: rs139633388
rs139633388
1.000 0.080 3 149178609 missense variant C/G snv 1.5E-03 1.6E-03
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1553761391
rs1553761391
1.000 0.080 3 149198573 splice acceptor variant -/AC delins
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1553762556
rs1553762556
1.000 0.080 3 149206167 splice donor variant C/T snv
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1559935542
rs1559935542
1.000 0.080 3 149178590 frameshift variant -/C delins
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1559940237
rs1559940237
1.000 0.080 3 149185271 stop gained C/T snv
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 0
dbSNP: rs200683433
rs200683433
1.000 0.080 3 149212616 missense variant C/G snv 1.4E-04 2.8E-05
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 0
dbSNP: rs386134121
rs386134121
1.000 0.080 3 149221711 missense variant T/A snv
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 0
dbSNP: rs386134122
rs386134122
1.000 0.080 3 149210281 missense variant G/C snv
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 0
dbSNP: rs386134123
rs386134123
1.000 0.080 3 149210226 missense variant A/C;G snv 4.0E-06; 4.0E-06
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 0
dbSNP: rs386134126
rs386134126
1.000 0.080 3 149207551 missense variant C/G snv
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 0
dbSNP: rs386134127
rs386134127
1.000 0.080 3 149206327 missense variant G/T snv
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 0
dbSNP: rs386134128
rs386134128
1.000 0.080 3 149206253 missense variant A/G;T snv
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 0
dbSNP: rs386134129
rs386134129
1.000 0.080 3 149186723 missense variant C/T snv
CUI: C0878682
Disease: Ceruloplasmin deficiency
Ceruloplasmin deficiency
Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 0