Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs121912745
rs121912745
0.807 0.200 17 44255708 missense variant G/A;T snv
Ovalocytosis, Malaysian-Melanesian-Filipino Type
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs769664228
rs769664228
1.000 0.080 17 44258043 inframe deletion GGCAGCCAGGACCTGGGGGCTGAATGC/- delins 4.8E-05 4.2E-05
Ovalocytosis, Malaysian-Melanesian-Filipino Type
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs121912748
rs121912748
0.790 0.200 17 44253327 missense variant C/T snv 4.0E-05 2.1E-05
Ovalocytosis, Malaysian-Melanesian-Filipino Type
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.080 1.000 8 1999 2019
dbSNP: rs121912753
rs121912753
0.827 0.200 17 44251583 missense variant A/G snv
Ovalocytosis, Malaysian-Melanesian-Filipino Type
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.010 1.000 1 2004 2004
dbSNP: rs121912754
rs121912754
0.882 0.200 17 44255292 missense variant C/G;T snv
Ovalocytosis, Malaysian-Melanesian-Filipino Type
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.010 1.000 1 2004 2004