Variant | Gene | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||
---|---|---|---|---|---|---|---|---|---|---|
|
GA | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | CausalMutation | CLINVAR | Characteristics and spectrum of BRCA1 and BRCA2 mutations in 3,922 Korean patients with breast and ovarian cancer. | 22798144 | 2012 |
|||
|
G | 0.700 | CausalMutation | CLINVAR | A one-step prescreening for point mutations and large rearrangement in BRCA1 and BRCA2 genes using quantitative polymerase chain reaction and high-resolution melting curve analysis. | 20858050 | 2010 |
|||
|
G | 0.700 | CausalMutation | CLINVAR | Cross-sectional analysis of germline BRCA1 and BRCA2 mutations in Japanese patients suspected to have hereditary breast/ovarian cancer. | 19016756 | 2008 |
|||
|
G | 0.700 | CausalMutation | CLINVAR | Comprehensive BRCA1 and BRCA2 mutational profile in Lithuania. | 25066507 | 2014 |
|||
|
AGA | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | GeneticVariation | CLINVAR | Identification of fifteen novel germline variants in the BRCA1 3'UTR reveals a variant in a breast cancer case that introduces a functional miR-103 target site. | 22753153 | 2012 |
|||
|
AT | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
TGGTTTCTTCCATTGACCACATCTCCTCTGACTTCAAAATCATGCTGAAAGAAA | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | Comprehensive spectrum of BRCA1 and BRCA2 deleterious mutations in breast cancer in Asian countries. | 26187060 | 2016 |
|||
|
CA | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
GA | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR |