Variant | Gene | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||
---|---|---|---|---|---|---|---|---|---|---|
|
G | 0.800 | CausalMutation | CLINVAR | ||||||
|
C | 0.800 | CausalMutation | CLINVAR | ||||||
|
G | 0.800 | CausalMutation | CLINVAR | ||||||
|
T | 0.710 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | GeneticVariation | CLINVAR | ||||||
|
GT | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
AGGGCAGCGTGGGGATGATCTT | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | GeneticVariation | CLINVAR | ||||||
|
GAGGGCAGCGTGGGGATGATCT | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
0.010 | GeneticVariation | BEFREE | Saethre-Chotzen syndrome: notable intrafamilial phenotypic variability in a large family with Q28X TWIST mutation. | 11977182 | 2002 |
||||
|
G | 0.700 | GeneticVariation | CLINVAR | A comprehensive screen for TWIST mutations in patients with craniosynostosis identifies a new microdeletion syndrome of chromosome band 7p21.1. | 9792856 | 1998 |
|||
|
GGGCAGCGTGGGGATGATCTTC | 0.700 | CausalMutation | CLINVAR | A Twist in fate: evolutionary comparison of Twist structure and function. | 11992718 | 2002 |
|||
|
G | 0.700 | GeneticVariation | CLINVAR | A Twist in fate: evolutionary comparison of Twist structure and function. | 11992718 | 2002 |
|||
|
0.800 | GeneticVariation | UNIPROT | Another TWIST on Baller-Gerold syndrome. | 11754069 | 2001 |
||||
|
0.800 | GeneticVariation | UNIPROT | Another TWIST on Baller-Gerold syndrome. | 11754069 | 2001 |
||||
|
0.800 | GeneticVariation | UNIPROT | Another TWIST on Baller-Gerold syndrome. | 11754069 | 2001 |
||||
|
A | 0.700 | CausalMutation | CLINVAR | Breast cancer risk is not increased in individuals with TWIST1 mutation confirmed Saethre-Chotzen syndrome: an Australian multicenter study. | 19373776 | 2009 |
|||
|
G | 0.700 | GeneticVariation | CLINVAR | Breast cancer risk is not increased in individuals with TWIST1 mutation confirmed Saethre-Chotzen syndrome: an Australian multicenter study. | 19373776 | 2009 |
|||
|
G | 0.700 | GeneticVariation | CLINVAR | Clinical and genetic analysis of patients with Saethre-Chotzen syndrome. | 15923834 | 2005 |
|||
|
C | 0.700 | GeneticVariation | CLINVAR | Clinical and genetic analysis of patients with Saethre-Chotzen syndrome. | 15923834 | 2005 |
|||
|
G | 0.700 | GeneticVariation | CLINVAR | Expanding the mutation spectrum in 182 Spanish probands with craniosynostosis: identification and characterization of novel TCF12 variants. | 25271085 | 2015 |