PQBP1, polyglutamine binding protein 1, 10084

N. diseases: 118; N. variants: 7
Disease: Renpenning syndrome 1 ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs121917899
rs121917899 		1.000 0.080 X 48901944 missense variant A/G snv
CUI: C0796135
Disease: Renpenning syndrome 1
Renpenning syndrome 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.810 1.000 6 2003 2015
dbSNP: rs606231193
rs606231193 		0.925 0.080 X 48902391 frameshift variant AGAG/-;AG;AGAGAG delins
CUI: C0796135
Disease: Renpenning syndrome 1
Renpenning syndrome 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 4 1994 2007
dbSNP: rs606231196
rs606231196 		1.000 0.080 X 48902788 splice donor variant -/C;CCCC delins
CUI: C0796135
Disease: Renpenning syndrome 1
Renpenning syndrome 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 3 1998 2016
dbSNP: rs1557041672
rs1557041672 		1.000 0.080 X 48902740 stop gained C/T snv
CUI: C0796135
Disease: Renpenning syndrome 1
Renpenning syndrome 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 1 2011 2011
dbSNP: rs606231197
rs606231197 		1.000 0.080 X 48902484 frameshift variant GAGCTGGCTCCCTATCCCAAGAG/- delins
CUI: C0796135
Disease: Renpenning syndrome 1
Renpenning syndrome 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0