CDKN2A, cyclin dependent kinase inhibitor 2A, 1029

N. diseases: 1314; N. variants: 146
Disease: Neoplastic Syndromes, Hereditary ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs104894097
rs104894097 		0.807 0.240 9 21974757 missense variant C/A;G;T snv 1.7E-05; 1.3E-05
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 19 1995 2015
dbSNP: rs104894095
rs104894095 		0.827 0.120 9 21971200 missense variant C/G;T snv 9.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 16 1995 2010
dbSNP: rs730881674
rs730881674 		1.000 0.120 9 21971116 frameshift variant GTGAGAGTGGCGGGGTCGG/- delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 15 1995 2015
dbSNP: rs878853650
rs878853650 		0.925 0.120 9 21974733 missense variant A/G snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 15 1995 2010
dbSNP: rs199907548
rs199907548 		0.882 0.160 9 21974682 missense variant A/C;G snv 6.3E-04
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 14 1994 2016
dbSNP: rs768966657
rs768966657 		1.000 0.120 9 21971021 inframe insertion -/ACG delins 1.3E-05
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 14 1996 2016
dbSNP: rs1800586
rs1800586 		0.851 0.240 9 21974861 5 prime UTR variant C/A;G;T snv 4.3E-05; 6.1E-05; 8.7E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 13 1999 2016
dbSNP: rs587780668
rs587780668 		0.925 0.120 9 21974796 start lost GGCTCCATGCTGCTCCCCGCCGCC/-;GGCTCCATGCTGCTCCCCGCCGCCGGCTCCATGCTGCTCCCCGCCGCC delins 1.5E-04
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 13 1995 2015
dbSNP: rs372670098
rs372670098 		9 21971153 missense variant T/C snv 9.5E-06 2.8E-05
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 12 1998 2015
dbSNP: rs559848002
rs559848002 		0.925 0.120 9 21971147 missense variant T/C;G snv 4.7E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 12 1994 2011
dbSNP: rs587782792
rs587782792 		9 21971108 missense variant T/G snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 10 1998 2014
dbSNP: rs104894098
rs104894098 		0.851 0.200 9 21970982 missense variant A/T snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 9 1994 2013
dbSNP: rs104894109
rs104894109 		0.925 0.120 9 21971192 missense variant C/A;T snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 9 1998 2011
dbSNP: rs876658534
rs876658534 		0.925 0.120 9 21971156 missense variant GC/AA mnv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 9 1998 2011
dbSNP: rs104894099
rs104894099 		0.851 0.200 9 21971183 missense variant A/C;T snv 4.6E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 8 1998 2011
dbSNP: rs34968276
rs34968276 		0.776 0.240 9 21971110 stop gained G/A;C;T snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 8 1999 2017
dbSNP: rs45476696
rs45476696 		0.925 0.200 9 21970902 stop gained C/A;T snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 8 1998 2015
dbSNP: rs587778189
rs587778189 		1.000 9 21974679 missense variant T/A;C;G snv 4.0E-06; 4.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 8 2002 2013
dbSNP: rs121913386
rs121913386 		0.807 0.120 9 21971018 missense variant G/A;T snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 7 1996 2011
dbSNP: rs730881675
rs730881675 		0.925 0.200 9 21971106 frameshift variant TCGTGCACGGGTCG/- delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 7 1994 2014
dbSNP: rs864622263
rs864622263 		1.000 0.120 9 21974781 missense variant A/C;T snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 6 1998 2011
dbSNP: rs1131691186
rs1131691186 		0.925 0.120 9 21974761 missense variant C/A;T snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 5 2002 2014
dbSNP: rs730881673
rs730881673 		1.000 0.120 9 21974696 stop gained -/T;TT delins 4.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 5 1998 2014
dbSNP: rs876658556
rs876658556 		1.000 0.120 9 21974784 stop gained C/T snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 5 1996 2008
dbSNP: rs121913381
rs121913381 		9 21971037 missense variant C/A;T snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 4 1998 2011