CDKN2A, cyclin dependent kinase inhibitor 2A, 1029
N. diseases: 1314; N. variants: 146
Source: ALL
Variant | DSI v | DPI v | Chr | Position | Consequence | Alleles | Class | AF EXOME | AF GENOME | Disease | Disease Class | Score vda | EI vda | N. PMIDs | First Ref. | Last Ref. | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
0.807 | 0.240 | 9 | 21974757 | missense variant | C/A;G;T | snv | 1.7E-05; 1.3E-05 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 19 | 1995 | 2015 | |||||||
|
0.827 | 0.120 | 9 | 21971200 | missense variant | C/G;T | snv | 9.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 16 | 1995 | 2010 | |||||||
|
1.000 | 0.120 | 9 | 21971116 | frameshift variant | GTGAGAGTGGCGGGGTCGG/- | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 15 | 1995 | 2015 | ||||||||
|
0.925 | 0.120 | 9 | 21974733 | missense variant | A/G | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 15 | 1995 | 2010 | ||||||||
|
0.882 | 0.160 | 9 | 21974682 | missense variant | A/C;G | snv | 6.3E-04 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 14 | 1994 | 2016 | |||||||
|
1.000 | 0.120 | 9 | 21971021 | inframe insertion | -/ACG | delins | 1.3E-05 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 14 | 1996 | 2016 | |||||||
|
0.851 | 0.240 | 9 | 21974861 | 5 prime UTR variant | C/A;G;T | snv | 4.3E-05; 6.1E-05; 8.7E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 13 | 1999 | 2016 | |||||||
|
0.925 | 0.120 | 9 | 21974796 | start lost | GGCTCCATGCTGCTCCCCGCCGCC/-;GGCTCCATGCTGCTCCCCGCCGCCGGCTCCATGCTGCTCCCCGCCGCC | delins | 1.5E-04 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 13 | 1995 | 2015 | |||||||
|
9 | 21971153 | missense variant | T/C | snv | 9.5E-06 | 2.8E-05 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 12 | 1998 | 2015 | ||||||||
|
0.925 | 0.120 | 9 | 21971147 | missense variant | T/C;G | snv | 4.7E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 12 | 1994 | 2011 | |||||||
|
9 | 21971108 | missense variant | T/G | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 10 | 1998 | 2014 | ||||||||||
|
0.851 | 0.200 | 9 | 21970982 | missense variant | A/T | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 9 | 1994 | 2013 | ||||||||
|
0.925 | 0.120 | 9 | 21971192 | missense variant | C/A;T | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 9 | 1998 | 2011 | ||||||||
|
0.925 | 0.120 | 9 | 21971156 | missense variant | GC/AA | mnv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 9 | 1998 | 2011 | ||||||||
|
0.851 | 0.200 | 9 | 21971183 | missense variant | A/C;T | snv | 4.6E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 8 | 1998 | 2011 | |||||||
|
0.776 | 0.240 | 9 | 21971110 | stop gained | G/A;C;T | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 8 | 1999 | 2017 | ||||||||
|
0.925 | 0.200 | 9 | 21970902 | stop gained | C/A;T | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 8 | 1998 | 2015 | ||||||||
|
1.000 | 9 | 21974679 | missense variant | T/A;C;G | snv | 4.0E-06; 4.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 8 | 2002 | 2013 | ||||||||
|
0.807 | 0.120 | 9 | 21971018 | missense variant | G/A;T | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 7 | 1996 | 2011 | ||||||||
|
0.925 | 0.200 | 9 | 21971106 | frameshift variant | TCGTGCACGGGTCG/- | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 7 | 1994 | 2014 | ||||||||
|
1.000 | 0.120 | 9 | 21974781 | missense variant | A/C;T | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 6 | 1998 | 2011 | ||||||||
|
0.925 | 0.120 | 9 | 21974761 | missense variant | C/A;T | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 5 | 2002 | 2014 | ||||||||
|
1.000 | 0.120 | 9 | 21974696 | stop gained | -/T;TT | delins | 4.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 5 | 1998 | 2014 | |||||||
|
1.000 | 0.120 | 9 | 21974784 | stop gained | C/T | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 5 | 1996 | 2008 | ||||||||
|
9 | 21971037 | missense variant | C/A;T | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 4 | 1998 | 2011 |