ADAMTS13, ADAM metallopeptidase with thrombospondin type 1 motif 13, 11093
N. diseases: 229; N. variants: 83
Source: ALL
Variant | DSI v | DPI v | Chr | Position | Consequence | Alleles | Class | AF EXOME | AF GENOME | Disease | Disease Class | Score vda | EI vda | N. PMIDs | First Ref. | Last Ref. | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
1.000 | 0.080 | 9 | 133459038 | frameshift variant | -/A | delins |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 9 | 133456596 | frameshift variant | -/T | delins |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 9 | 133437895 | missense variant | A/G | snv | 4.0E-06 |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.800 | 1.000 | 20 | 2001 | 2011 | |||||||
|
1.000 | 0.080 | 9 | 133442403 | missense variant | A/G | snv | 7.0E-06 |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.700 | 1.000 | 20 | 2001 | 2011 | |||||||
|
9 | 133440318 | intron variant | A/G | snv | 0.57 |
|
Nutritional and Metabolic Diseases; Endocrine System Diseases | 0.010 | 1.000 | 1 | 2018 | 2018 | |||||||||
|
1.000 | 0.040 | 9 | 133440154 | intron variant | A/G | snv | 0.26 |
|
Pathological Conditions, Signs and Symptoms | 0.700 | 1.000 | 1 | 2018 | 2018 | |||||||
|
0.925 | 0.120 | 9 | 133458632 | intron variant | A/G | snv | 0.79 |
|
0.700 | 1.000 | 1 | 2008 | 2008 | ||||||||
|
0.925 | 0.120 | 9 | 133458632 | intron variant | A/G | snv | 0.79 |
|
Cardiovascular Diseases | 0.700 | 1.000 | 1 | 2011 | 2011 | |||||||
|
0.925 | 0.120 | 9 | 133458632 | intron variant | A/G | snv | 0.79 |
|
0.700 | 1.000 | 1 | 2012 | 2012 | ||||||||
|
0.925 | 0.120 | 9 | 133458632 | intron variant | A/G | snv | 0.79 |
|
0.700 | 1.000 | 1 | 2008 | 2008 | ||||||||
|
0.925 | 0.120 | 9 | 133458632 | intron variant | A/G | snv | 0.79 |
|
0.700 | 1.000 | 1 | 2017 | 2017 | ||||||||
|
0.925 | 0.120 | 9 | 133458632 | intron variant | A/G | snv | 0.79 |
|
0.700 | 1.000 | 1 | 2017 | 2017 | ||||||||
|
0.925 | 0.120 | 9 | 133458632 | intron variant | A/G | snv | 0.79 |
|
Nervous System Diseases; Cardiovascular Diseases | 0.700 | 1.000 | 1 | 2017 | 2017 | |||||||
|
0.925 | 0.120 | 9 | 133458632 | intron variant | A/G | snv | 0.79 |
|
Infections; Nervous System Diseases | 0.010 | 1.000 | 1 | 2011 | 2011 | |||||||
|
0.925 | 0.120 | 9 | 133458632 | intron variant | A/G | snv | 0.79 |
|
0.700 | 1.000 | 1 | 2008 | 2008 | ||||||||
|
1.000 | 0.080 | 9 | 133442447 | missense variant | A/G;T | snv | 8.0E-06; 4.0E-06 |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.800 | 1.000 | 21 | 2001 | 2011 | |||||||
|
1.000 | 0.080 | 9 | 133430025 | missense variant | A/G;T | snv | 4.6E-06 |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.700 | 1.000 | 20 | 2001 | 2011 | |||||||
|
1.000 | 0.080 | 9 | 133458996 | inframe deletion | ACAGCGTTCCATGGGCAGCAGGTGCTCTACTGGGAGTCAGAGAGCAGCCAGGCTGAGATGGAGTTCAGCGAGGGCTTCCTGAAGGCTCAGGCCAGCCTGCGGGGCCAGTACTGGACC/- | delins |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 9 | 133443515 | frameshift variant | AGCTGTGGCGCTGGAAACCTGCAACC/- | delins |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 9 | 133442676 | missense variant | C/A | snv | 9.6E-05 |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.010 | 1.000 | 1 | 2012 | 2012 | |||||||
|
9 | 133451246 | intron variant | C/A | snv | 0.25 |
|
0.700 | 1.000 | 1 | 2019 | 2019 | ||||||||||
|
1.000 | 0.080 | 9 | 133428735 | missense variant | C/A;G | snv |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.700 | 1.000 | 20 | 2001 | 2011 | ||||||||
|
0.925 | 0.120 | 9 | 133436862 | missense variant | C/A;G | snv | 0.38 | 0.32 |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.010 | 1.000 | 1 | 2006 | 2006 | ||||||
|
0.925 | 0.120 | 9 | 133436862 | missense variant | C/A;G | snv | 0.38 | 0.32 |
|
Cardiovascular Diseases | 0.010 | 1.000 | 1 | 2010 | 2010 | ||||||
|
0.925 | 0.080 | 9 | 133454548 | missense variant | C/A;T | snv | 8.3E-04 |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.810 | 1.000 | 23 | 2001 | 2018 |