Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs387906343
rs387906343
1.000 0.080 9 133459038 frameshift variant -/A delins
Congenital Thrombotic Thrombocytopenic Purpura
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs387906341
rs387906341
1.000 0.080 9 133456596 frameshift variant -/T delins
Congenital Thrombotic Thrombocytopenic Purpura
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs121908473
rs121908473
1.000 0.080 9 133437895 missense variant A/G snv 4.0E-06
Congenital Thrombotic Thrombocytopenic Purpura
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases 0.800 1.000 20 2001 2011
dbSNP: rs281875335
rs281875335
1.000 0.080 9 133442403 missense variant A/G snv 7.0E-06
Congenital Thrombotic Thrombocytopenic Purpura
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases 0.700 1.000 20 2001 2011
dbSNP: rs2073932
rs2073932
9 133440318 intron variant A/G snv 0.57
CUI: C0011849
Disease: Diabetes Mellitus
Diabetes Mellitus
Nutritional and Metabolic Diseases; Endocrine System Diseases 0.010 1.000 1 2018 2018
dbSNP: rs2073933
rs2073933
1.000 0.040 9 133440154 intron variant A/G snv 0.26
Autosomal dominant compelling helio ophthalmic outburst syndrome
Pathological Conditions, Signs and Symptoms 0.700 1.000 1 2018 2018
dbSNP: rs4962153
rs4962153
0.925 0.120 9 133458632 intron variant A/G snv 0.79
CUI: C0201850
Disease: Alkaline phosphatase measurement
Alkaline phosphatase measurement
0.700 1.000 1 2008 2008
dbSNP: rs4962153
rs4962153
0.925 0.120 9 133458632 intron variant A/G snv 0.79
CUI: C1861172
Disease: Venous Thromboembolism
Venous Thromboembolism
Cardiovascular Diseases 0.700 1.000 1 2011 2011
dbSNP: rs4962153
rs4962153
0.925 0.120 9 133458632 intron variant A/G snv 0.79
Corpuscular Hemoglobin Concentration Mean
0.700 1.000 1 2012 2012
dbSNP: rs4962153
rs4962153
0.925 0.120 9 133458632 intron variant A/G snv 0.79
CUI: C1287351
Disease: Finding of liver enzyme levels
Finding of liver enzyme levels
0.700 1.000 1 2008 2008
dbSNP: rs4962153
rs4962153
0.925 0.120 9 133458632 intron variant A/G snv 0.79
CUI: C2239219
Disease: von Willebrand's factor (lab test)
von Willebrand's factor (lab test)
0.700 1.000 1 2017 2017
dbSNP: rs4962153
rs4962153
0.925 0.120 9 133458632 intron variant A/G snv 0.79
CUI: C2242817
Disease: Homocysteine measurement
Homocysteine measurement
0.700 1.000 1 2017 2017
dbSNP: rs4962153
rs4962153
0.925 0.120 9 133458632 intron variant A/G snv 0.79
CUI: C0948008
Disease: Ischemic stroke
Ischemic stroke
Nervous System Diseases; Cardiovascular Diseases 0.700 1.000 1 2017 2017
dbSNP: rs4962153
rs4962153
0.925 0.120 9 133458632 intron variant A/G snv 0.79
CUI: C0024534
Disease: Malaria, Cerebral
Malaria, Cerebral
Infections; Nervous System Diseases 0.010 1.000 1 2011 2011
dbSNP: rs4962153
rs4962153
0.925 0.120 9 133458632 intron variant A/G snv 0.79
CUI: C0428321
Disease: Measurement of liver enzyme
Measurement of liver enzyme
0.700 1.000 1 2008 2008
dbSNP: rs281875307
rs281875307
1.000 0.080 9 133442447 missense variant A/G;T snv 8.0E-06; 4.0E-06
Congenital Thrombotic Thrombocytopenic Purpura
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases 0.800 1.000 21 2001 2011
dbSNP: rs281875285
rs281875285
1.000 0.080 9 133430025 missense variant A/G;T snv 4.6E-06
Congenital Thrombotic Thrombocytopenic Purpura
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases 0.700 1.000 20 2001 2011
dbSNP: rs1554797078
rs1554797078
1.000 0.080 9 133458996 inframe deletion ACAGCGTTCCATGGGCAGCAGGTGCTCTACTGGGAGTCAGAGAGCAGCCAGGCTGAGATGGAGTTCAGCGAGGGCTTCCTGAAGGCTCAGGCCAGCCTGCGGGGCCAGTACTGGACC/- delins
Congenital Thrombotic Thrombocytopenic Purpura
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs387906342
rs387906342
1.000 0.080 9 133443515 frameshift variant AGCTGTGGCGCTGGAAACCTGCAACC/- delins
Congenital Thrombotic Thrombocytopenic Purpura
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs138014548
rs138014548
1.000 0.080 9 133442676 missense variant C/A snv 9.6E-05
Congenital Thrombotic Thrombocytopenic Purpura
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases 0.010 1.000 1 2012 2012
dbSNP: rs28680325
rs28680325
9 133451246 intron variant C/A snv 0.25
CUI: C2239219
Disease: von Willebrand's factor (lab test)
von Willebrand's factor (lab test)
0.700 1.000 1 2019 2019
dbSNP: rs281875293
rs281875293
1.000 0.080 9 133428735 missense variant C/A;G snv
Congenital Thrombotic Thrombocytopenic Purpura
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases 0.700 1.000 20 2001 2011
dbSNP: rs2301612
rs2301612
0.925 0.120 9 133436862 missense variant C/A;G snv 0.38 0.32
Purpura, Thrombotic Thrombocytopenic
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases 0.010 1.000 1 2006 2006
dbSNP: rs2301612
rs2301612
0.925 0.120 9 133436862 missense variant C/A;G snv 0.38 0.32
CUI: C1956346
Disease: Coronary Artery Disease
Coronary Artery Disease
Cardiovascular Diseases 0.010 1.000 1 2010 2010
dbSNP: rs142572218
rs142572218
0.925 0.080 9 133454548 missense variant C/A;T snv 8.3E-04
Congenital Thrombotic Thrombocytopenic Purpura
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases 0.810 1.000 23 2001 2018