COL3A1, collagen type III alpha 1 chain, 1281

N. diseases: 301; N. variants: 402
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1057521106
rs1057521106 		1.000 0.160 2 188991016 stop gained C/A;T snv 4.0E-06
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1057524653
rs1057524653 		1.000 0.160 2 188995074 missense variant G/A;C snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1060500187
rs1060500187 		1.000 0.160 2 189010187 stop gained G/A snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1060500193
rs1060500193 		1.000 0.160 2 189001425 missense variant G/A snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1060500199
rs1060500199 		1.000 0.160 2 188996167 frameshift variant C/- delins
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1060500200
rs1060500200 		1.000 0.160 2 188984761 frameshift variant T/- del
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1060500203
rs1060500203 		1.000 0.160 2 189007501 missense variant G/T snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1060500204
rs1060500204 		1.000 0.160 2 188994540 splice acceptor variant G/C snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1085307896
rs1085307896 		1.000 0.160 2 189004072 missense variant G/A snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs112371422
rs112371422 		1.000 0.160 2 189007569 stop gained C/G;T snv 8.0E-05
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs112978464
rs112978464 		1.000 0.160 2 189004136 missense variant G/A snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs113871730
rs113871730 		1.000 0.160 2 188991697 missense variant G/A snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs121912920
rs121912920 		0.925 0.160 2 189002316 missense variant G/A snv
CUI: C4540530
Disease: EHLERS-DANLOS SYNDROME, NONVASCULAR VARIANT
EHLERS-DANLOS SYNDROME, NONVASCULAR VARIANT 		0.700 0
dbSNP: rs121912923
rs121912923 		0.882 0.160 2 188996479 missense variant G/A;C;T snv
CUI: C4707243
Disease: Familial thoracic aortic aneurysm and aortic dissection
Familial thoracic aortic aneurysm and aortic dissection 		0.700 0
dbSNP: rs121912923
rs121912923 		0.882 0.160 2 188996479 missense variant G/A;C;T snv
CUI: C0002940
Disease: Aneurysm
Aneurysm 		Cardiovascular Diseases 0.700 0
dbSNP: rs1553507180
rs1553507180 		0.925 0.040 2 188988083 frameshift variant C/- delins
CUI: C0002940
Disease: Aneurysm
Aneurysm 		Cardiovascular Diseases 0.700 0
dbSNP: rs1553507180
rs1553507180 		0.925 0.040 2 188988083 frameshift variant C/- delins
CUI: C4707243
Disease: Familial thoracic aortic aneurysm and aortic dissection
Familial thoracic aortic aneurysm and aortic dissection 		0.700 0
dbSNP: rs1553507265
rs1553507265 		1.000 0.160 2 188988611 frameshift variant C/- delins
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1553507345
rs1553507345 		1.000 0.040 2 188989397 missense variant GC/AA mnv
CUI: C0340643
Disease: Dissection of aorta
Dissection of aorta 		Cardiovascular Diseases 0.700 0
dbSNP: rs1553507867
rs1553507867 		0.925 0.040 2 188994066 missense variant G/A snv
CUI: C0002940
Disease: Aneurysm
Aneurysm 		Cardiovascular Diseases 0.700 0
dbSNP: rs1553507867
rs1553507867 		0.925 0.040 2 188994066 missense variant G/A snv
CUI: C4707243
Disease: Familial thoracic aortic aneurysm and aortic dissection
Familial thoracic aortic aneurysm and aortic dissection 		0.700 0
dbSNP: rs1553508025
rs1553508025 		1.000 0.160 2 188995033 splice acceptor variant TCATTATTTTCAGGGTGCCCCTGGGTTCCGAGGACCTGCTGGACCAAATGGCATCCC/- del
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1553508039
rs1553508039 		1.000 0.160 2 188995101 splice donor variant T/C snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1553508338
rs1553508338 		1.000 0.160 2 188997165 missense variant G/A snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1553508473
rs1553508473 		1.000 0.040 2 188997727 missense variant G/A snv
CUI: C0345050
Disease: Congenital aneurysm of ascending aorta
Congenital aneurysm of ascending aorta 		Cardiovascular Diseases 0.700 0