COL3A1, collagen type III alpha 1 chain, 1281

N. diseases: 301; N. variants: 402
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1553509187
rs1553509187 		1.000 0.160 2 189004082 missense variant G/A snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1553509208
rs1553509208 		1.000 0.160 2 189004261 frameshift variant C/- del
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1553509630
rs1553509630 		1.000 0.160 2 189007942 splice region variant AG/- del
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1553509726
rs1553509726 		1.000 0.160 2 189008925 missense variant G/A snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1553510000
rs1553510000 		1.000 0.160 2 189011640 stop gained G/T snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1559052609
rs1559052609 		1.000 0.160 2 188984814 stop gained G/A snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1559053784
rs1559053784 		1.000 0.160 2 188988139 splice region variant GTATAGC/ACA delins
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1559055162
rs1559055162 		1.000 0.160 2 188991725 splice region variant AG/- delins
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1559056438
rs1559056438 		0.925 0.200 2 188994727 missense variant G/A snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1559056438
rs1559056438 		0.925 0.200 2 188994727 missense variant G/A snv
CUI: C0347646
Disease: Perforation of colon
Perforation of colon 		Digestive System Diseases 0.700 0
dbSNP: rs1559057346
rs1559057346 		1.000 0.160 2 188996499 splice region variant AG/- delins
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1559061242
rs1559061242 		1.000 0.160 2 189005368 missense variant GG/AC mnv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs267599120
rs267599120 		1.000 0.160 2 188988590 missense variant G/A;C snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs375737772
rs375737772 		1.000 0.160 2 188996419 stop gained C/T snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs387906557
rs387906557 		1.000 0.160 2 188985737 missense variant G/C snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs397509369
rs397509369 		1.000 0.160 2 189002343 missense variant G/A snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs397509371
rs397509371 		1.000 0.160 2 189003067 splice region variant G/T snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs397509372
rs397509372 		1.000 0.160 2 188996501 splice region variant G/A;T snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs397509373
rs397509373 		1.000 0.160 2 189004365 splice donor variant G/A snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs397509374
rs397509374 		1.000 0.160 2 189002995 inframe deletion GGGTGAGAAAGGTGAAGGAGGCCCTCC/- delins
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs397509375
rs397509375 		1.000 0.160 2 188988140 splice region variant T/A;C snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs397509376
rs397509376 		1.000 0.160 2 188997394 splice region variant G/A;T snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs553203474
rs553203474 		1.000 0.160 2 188999570 missense variant G/A snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs587779416
rs587779416 		1.000 0.160 2 189005395 missense variant G/T snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs587779417
rs587779417 		1.000 0.160 2 189003457 missense variant G/A snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0