Disease: Glaucoma of childhood ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs55989760
rs55989760 		0.882 0.120 2 38071195 missense variant C/G;T snv 2.9E-04
CUI: C2981140
Disease: Glaucoma of childhood
Glaucoma of childhood 		Eye Diseases 0.700 1.000 15 1998 2016
dbSNP: rs72549387
rs72549387 		0.790 0.120 2 38075218 stop gained C/G;T snv 1.7E-04
CUI: C2981140
Disease: Glaucoma of childhood
Glaucoma of childhood 		Eye Diseases 0.700 1.000 8 2001 2016
dbSNP: rs587778873
rs587778873 		0.925 0.040 2 38071145 frameshift variant TGGCATGAGG/-;TGGCATGAGGTGGCATGAGG delins
CUI: C2981140
Disease: Glaucoma of childhood
Glaucoma of childhood 		Eye Diseases 0.700 1.000 7 1998 2017
dbSNP: rs771076928
rs771076928 		1.000 0.040 2 38074854 frameshift variant C/- delins 4.9E-05
CUI: C2981140
Disease: Glaucoma of childhood
Glaucoma of childhood 		Eye Diseases 0.700 1.000 6 2002 2016
dbSNP: rs587778875
rs587778875 		1.000 0.040 2 38074520 frameshift variant -/G delins 2.6E-05 3.5E-05
CUI: C2981140
Disease: Glaucoma of childhood
Glaucoma of childhood 		Eye Diseases 0.700 1.000 4 1997 2015
dbSNP: rs72549380
rs72549380 		1.000 0.040 2 38071278 frameshift variant TCTGCCTGCACTC/- del 2.2E-04 2.3E-04
CUI: C2981140
Disease: Glaucoma of childhood
Glaucoma of childhood 		Eye Diseases 0.700 1.000 2 1997 2017
dbSNP: rs766425037
rs766425037 		1.000 0.040 2 38074559 frameshift variant A/- delins 2.9E-05 1.4E-05
CUI: C2981140
Disease: Glaucoma of childhood
Glaucoma of childhood 		Eye Diseases 0.700 1.000 2 2007 2009
dbSNP: rs749073455
rs749073455 		1.000 0.040 2 38071009 frameshift variant C/- delins 4.4E-05 2.8E-05
CUI: C2981140
Disease: Glaucoma of childhood
Glaucoma of childhood 		Eye Diseases 0.700 0
dbSNP: rs893198212
rs893198212 		1.000 0.040 2 38071052 stop gained C/A;T snv
CUI: C2981140
Disease: Glaucoma of childhood
Glaucoma of childhood 		Eye Diseases 0.700 0
dbSNP: rs1221648356
rs1221648356 		0.851 0.080 2 38071245 frameshift variant G/- delins
CUI: C2981140
Disease: Glaucoma of childhood
Glaucoma of childhood 		Eye Diseases 0.010 1.000 1 2009 2009
dbSNP: rs28936700
rs28936700 		0.776 0.120 2 38075207 missense variant C/G;T snv 5.0E-06; 3.2E-04
CUI: C2981140
Disease: Glaucoma of childhood
Glaucoma of childhood 		Eye Diseases 0.010 1.000 1 2011 2011
dbSNP: rs745378110
rs745378110 		0.851 0.080 2 38071247 frameshift variant C/- del
CUI: C2981140
Disease: Glaucoma of childhood
Glaucoma of childhood 		Eye Diseases 0.010 1.000 1 2009 2009