LRIG1, leucine rich repeats and immunoglobulin like domains 1, 26018
N. diseases: 83; N. variants: 13
Source: ALL
Variant | DSI v | DPI v | Chr | Position | Consequence | Alleles | Class | AF EXOME | AF GENOME | Disease | Disease Class | Score vda | EI vda | N. PMIDs | First Ref. | Last Ref. | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
1.000 | 0.040 | 3 | 66452557 | intron variant | A/C;G | snv |
|
Neoplasms; Nervous System Diseases | 0.700 | 1.000 | 1 | 2017 | 2017 | ||||||||
|
3 | 66429063 | intron variant | G/A | snv | 2.7E-02 |
|
0.700 | 1.000 | 1 | 2013 | 2013 | ||||||||||
|
1.000 | 0.080 | 3 | 66386050 | missense variant | G/A;T | snv | 2.9E-04; 4.0E-06 |
|
Female Urogenital Diseases and Pregnancy Complications; Male Urogenital Diseases | 0.700 | 1.000 | 1 | 2018 | 2018 | |||||||
|
3 | 66386662 | 3 prime UTR variant | T/C | snv | 0.30 |
|
0.700 | 1.000 | 1 | 2017 | 2017 | ||||||||||
|
1.000 | 0.040 | 3 | 66383098 | missense variant | G/A;C | snv | 1.4E-04; 4.0E-06 |
|
0.700 | 1.000 | 1 | 2018 | 2018 | ||||||||
|
1.000 | 0.040 | 3 | 66383098 | missense variant | G/A;C | snv | 1.4E-04; 4.0E-06 |
|
0.700 | 1.000 | 1 | 2018 | 2018 | ||||||||
|
1.000 | 0.040 | 3 | 66383098 | missense variant | G/A;C | snv | 1.4E-04; 4.0E-06 |
|
Pathological Conditions, Signs and Symptoms | 0.700 | 1.000 | 1 | 2018 | 2018 | |||||||
|
1.000 | 0.040 | 3 | 66383098 | missense variant | G/A;C | snv | 1.4E-04; 4.0E-06 |
|
0.700 | 1.000 | 1 | 2018 | 2018 | ||||||||
|
3 | 66381178 | intron variant | A/C;G | snv |
|
0.700 | 1.000 | 1 | 2016 | 2016 | |||||||||||
|
3 | 66381178 | intron variant | A/C;G | snv |
|
0.700 | 1.000 | 1 | 2010 | 2010 | |||||||||||
|
1.000 | 0.080 | 3 | 66384219 | missense variant | T/C | snv | 0.31 | 0.25 |
|
0.700 | 1.000 | 1 | 2019 | 2019 | |||||||
|
1.000 | 0.080 | 3 | 66384219 | missense variant | T/C | snv | 0.31 | 0.25 |
|
Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases | 0.700 | 1.000 | 1 | 2018 | 2018 | ||||||
|
1.000 | 0.080 | 3 | 66403767 | intron variant | G/A;C | snv |
|
Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases | 0.700 | 1.000 | 1 | 2018 | 2018 | ||||||||
|
3 | 66434532 | intron variant | A/C;T | snv |
|
Pathological Conditions, Signs and Symptoms | 0.700 | 1.000 | 1 | 2019 | 2019 | ||||||||||
|
3 | 66402550 | intron variant | GCATGGTGGGAAGGACCCAAGGT/-;GCATGGTGGGAAGGACCCAAGGTGCATGGTGGGAAGGACCCAAGGT | delins | 0.60 |
|
0.700 | 1.000 | 1 | 2016 | 2016 | ||||||||||
|
3 | 66402550 | intron variant | GCATGGTGGGAAGGACCCAAGGT/-;GCATGGTGGGAAGGACCCAAGGTGCATGGTGGGAAGGACCCAAGGT | delins | 0.60 |
|
0.700 | 1.000 | 1 | 2016 | 2016 | ||||||||||
|
3 | 66457018 | intron variant | A/G | snv | 0.57 |
|
0.700 | 1.000 | 1 | 2019 | 2019 | ||||||||||
|
1.000 | 3 | 66395177 | intron variant | A/G | snv | 5.2E-02 |
|
Nervous System Diseases | 0.700 | 1.000 | 1 | 2014 | 2014 | ||||||||
|
1.000 | 3 | 66395177 | intron variant | A/G | snv | 5.2E-02 |
|
0.700 | 1.000 | 1 | 2014 | 2014 | |||||||||
|
1.000 | 3 | 66395177 | intron variant | A/G | snv | 5.2E-02 |
|
0.700 | 1.000 | 1 | 2014 | 2014 | |||||||||
|
1.000 | 3 | 66395177 | intron variant | A/G | snv | 5.2E-02 |
|
0.700 | 1.000 | 1 | 2014 | 2014 | |||||||||
|
1.000 | 3 | 66395177 | intron variant | A/G | snv | 5.2E-02 |
|
0.700 | 1.000 | 1 | 2014 | 2014 | |||||||||
|
1.000 | 0.040 | 3 | 66452557 | intron variant | A/C;G | snv |
|
Neoplasms | 0.710 | 1.000 | 2 | 2017 | 2018 | ||||||||
|
0.790 | 0.080 | 3 | 66392011 | intron variant | C/G | snv | 0.66 |
|
Digestive System Diseases; Neoplasms | 0.700 | 1.000 | 2 | 2015 | 2019 | |||||||
|
0.790 | 0.080 | 3 | 66392011 | intron variant | C/G | snv | 0.66 |
|
0.700 | 1.000 | 2 | 2015 | 2019 |