KCNQ1-AS1, KCNQ1 antisense RNA 1, 338653

N. diseases: 6; N. variants: 14
Disease: Jervell And Lange-Nielsen Syndrome 1 ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs397508103
rs397508103 		1.000 0.080 11 2847863 frameshift variant CCAGAGAGGGCGGGGCCCAC/- delins
CUI: C4551509
Disease: Jervell And Lange-Nielsen Syndrome 1
Jervell And Lange-Nielsen Syndrome 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0