Disease: Long QT Syndrome ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs199473441
rs199473441 		1.000 0.120 11 2445099 start lost A/G;T snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs990778345
rs990778345 		1.000 0.120 11 2445168 missense variant C/T snv 7.2E-06
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.010 1.000 1 2013 2013
dbSNP: rs1554958043
rs1554958043 		1.000 0.120 11 2445192 stop gained A/T snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs397508096
rs397508096 		1.000 0.120 11 2445251 stop gained C/G snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 2 2005 2009
dbSNP: rs1060500623
rs1060500623 		1.000 0.120 11 2445295 frameshift variant C/- delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1435990592
rs1435990592 		1.000 0.120 11 2445295 frameshift variant CGGCCGCGCCC/- delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs199472678
rs199472678 		0.925 0.120 11 2445430 missense variant A/G snv 8.9E-06
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.020 1.000 2 2009 2011
dbSNP: rs120074191
rs120074191 		0.925 0.120 11 2445448 missense variant C/T snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.010 1.000 1 2001 2001
dbSNP: rs1554958132
rs1554958132 		1.000 0.120 11 2445478 frameshift variant -/GC delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs2074238
rs2074238 		1.000 0.120 11 2463573 intron variant T/A;C snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.010 1.000 1 2013 2013
dbSNP: rs120074192
rs120074192 		0.763 0.120 11 2527959 missense variant A/G snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.020 1.000 2 2003 2004
dbSNP: rs199472687
rs199472687 		0.827 0.120 11 2527962 missense variant G/A snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 7 2005 2015
dbSNP: rs199473451
rs199473451 		0.925 0.120 11 2527971 missense variant A/G snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 3 2003 2007
dbSNP: rs1064795333
rs1064795333 		1.000 0.120 11 2528005 frameshift variant CT/- delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.710 1.000 1 2014 2014
dbSNP: rs199472690
rs199472690 		0.925 0.120 11 2528011 missense variant T/G snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.010 1.000 1 1999 1999
dbSNP: rs762814879
rs762814879 		0.925 0.120 11 2528019 splice donor variant G/A snv 8.0E-06 7.0E-06
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs397508111
rs397508111 		0.882 0.120 11 2528023 splice region variant G/A;C snv 1.2E-05
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 2 1999 2013
dbSNP: rs179489
rs179489 		0.925 0.120 11 2570652 missense variant G/A;C snv 1.2E-05; 4.0E-06
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 7 1998 2015
dbSNP: rs139042529
rs139042529 		0.925 0.120 11 2570663 stop gained C/A;G;T snv 8.0E-06; 9.4E-04
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 4 2005 2015
dbSNP: rs763462603
rs763462603 		0.925 0.120 11 2570665 frameshift variant TCTGGTCCGCC/-;TCTGGTCCGCCTCTGGTCCGCC delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 1 2009 2009
dbSNP: rs199472696
rs199472696 		0.851 0.120 11 2570670 missense variant C/T snv 4.0E-06 1.4E-05
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 8 1997 2013
dbSNP: rs876661350
rs876661350 		1.000 0.120 11 2570678 stop gained G/A snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.010 1.000 1 2020 2020
dbSNP: rs120074177
rs120074177 		0.925 0.120 11 2570682 missense variant G/A;C snv 4.0E-06
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 5 1997 2014
dbSNP: rs794728568
rs794728568 		0.925 0.120 11 2570707 missense variant G/A;T snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 3 2012 2016
dbSNP: rs397508117
rs397508117 		0.925 0.120 11 2570712 frameshift variant -/G delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 2 1997 2011