Disease: Muscular hypotonia of the trunk ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1568925507
rs1568925507 		1.000 20 63438654 inframe insertion -/TCAAAGTGCTTCTGCCTGTGCTGCTCCTGAACCTTC delins
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases 0.700 0