SERPINC1, serpin family C member 1, 462

N. diseases: 184; N. variants: 46
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs121909546
rs121909546 		1.000 0.080 1 173903978 missense variant C/T snv
CUI: C0272375
Disease: Antithrombin III Deficiency
Antithrombin III Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.800 1.000 23 1986 2013
dbSNP: rs121909550
rs121909550 		1.000 0.080 1 173904007 missense variant G/A;C snv
CUI: C0272375
Disease: Antithrombin III Deficiency
Antithrombin III Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.800 1.000 21 1986 2013
dbSNP: rs121909555
rs121909555 		1.000 0.080 1 173903968 missense variant G/A snv
CUI: C0272375
Disease: Antithrombin III Deficiency
Antithrombin III Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.800 1.000 21 1986 2013
dbSNP: rs121909557
rs121909557 		1.000 0.080 1 173904044 missense variant C/T snv
CUI: C0272375
Disease: Antithrombin III Deficiency
Antithrombin III Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.800 1.000 21 1986 2013
dbSNP: rs121909558
rs121909558 		1.000 0.080 1 173914845 missense variant A/T snv
CUI: C0272375
Disease: Antithrombin III Deficiency
Antithrombin III Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.800 1.000 21 1986 2013
dbSNP: rs121909564
rs121909564 		1.000 0.080 1 173903902 missense variant G/A snv
CUI: C0272375
Disease: Antithrombin III Deficiency
Antithrombin III Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.800 1.000 21 1986 2013
dbSNP: rs121909565
rs121909565 		1.000 0.080 1 173909564 missense variant A/G snv
CUI: C0272375
Disease: Antithrombin III Deficiency
Antithrombin III Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.800 1.000 21 1986 2013
dbSNP: rs121909566
rs121909566 		1.000 0.080 1 173904013 missense variant C/T snv
CUI: C0272375
Disease: Antithrombin III Deficiency
Antithrombin III Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.800 1.000 21 1986 2013
dbSNP: rs121909572
rs121909572 		1.000 0.080 1 173910849 missense variant A/G snv
CUI: C0272375
Disease: Antithrombin III Deficiency
Antithrombin III Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.800 1.000 21 1986 2013
dbSNP: rs121909573
rs121909573 		1.000 0.080 1 173914582 missense variant A/G snv
CUI: C0272375
Disease: Antithrombin III Deficiency
Antithrombin III Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.800 1.000 21 1986 2013
dbSNP: rs387906575
rs387906575 		1.000 0.080 1 173914893 missense variant A/G snv
CUI: C0272375
Disease: Antithrombin III Deficiency
Antithrombin III Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.800 1.000 21 1986 2013
dbSNP: rs1423630663
rs1423630663 		1.000 0.080 1 173910764 missense variant A/G snv
CUI: C0272375
Disease: Antithrombin III Deficiency
Antithrombin III Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.700 1.000 20 1986 2013
dbSNP: rs483352854
rs483352854 		1.000 0.080 1 173910875 missense variant G/T snv
CUI: C0272375
Disease: Antithrombin III Deficiency
Antithrombin III Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.700 1.000 20 1986 2013
dbSNP: rs2227589
rs2227589 		0.925 0.120 1 173917078 intron variant C/T snv 9.6E-02
CUI: C1861172
Disease: Venous Thromboembolism
Venous Thromboembolism 		Cardiovascular Diseases 0.030 1.000 3 2013 2019
dbSNP: rs121909562
rs121909562 		1.000 0.080 1 173911942 stop gained G/A snv
CUI: C0272375
Disease: Antithrombin III Deficiency
Antithrombin III Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.700 1.000 2 1991 2013
dbSNP: rs1487411568
rs1487411568 		0.925 0.120 1 173903969 missense variant G/A;T snv 7.0E-06
CUI: C0149871
Disease: Deep Vein Thrombosis
Deep Vein Thrombosis 		Cardiovascular Diseases 0.700 1.000 1 2019 2019
dbSNP: rs1487411568
rs1487411568 		0.925 0.120 1 173903969 missense variant G/A;T snv 7.0E-06
CUI: C0272375
Disease: Antithrombin III Deficiency
Antithrombin III Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.700 1.000 1 2010 2010
dbSNP: rs2227589
rs2227589 		0.925 0.120 1 173917078 intron variant C/T snv 9.6E-02
CUI: C0149871
Disease: Deep Vein Thrombosis
Deep Vein Thrombosis 		Cardiovascular Diseases 0.010 1.000 1 2008 2008
dbSNP: rs2227589
rs2227589 		0.925 0.120 1 173917078 intron variant C/T snv 9.6E-02
CUI: C0272375
Disease: Antithrombin III Deficiency
Antithrombin III Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.010 1.000 1 2019 2019
dbSNP: rs2227611
rs2227611 		1 173906329 intron variant A/G snv 6.2E-02
CUI: C0202117
Disease: Low density lipoprotein cholesterol measurement
Low density lipoprotein cholesterol measurement 		0.700 1.000 1 2012 2012
dbSNP: rs2227611
rs2227611 		1 173906329 intron variant A/G snv 6.2E-02
CUI: C0428474
Disease: Serum LDL cholesterol measurement
Serum LDL cholesterol measurement 		0.700 1.000 1 2012 2012
dbSNP: rs3138521
rs3138521 		1.000 0.040 1 173917605 upstream gene variant CTAACCAAGGAAACAAACTTGGTTCATACCCA/TACCTGACTGAGGAGAAACTTGTCTGCAGGATTTTTTGTTTCTCGTTAACTAAATCAGAAGATAGAAATAGTTAATGTCCAAAAACTTCTAGCCCTCTACCTGTAATT delins
CUI: C0149871
Disease: Deep Vein Thrombosis
Deep Vein Thrombosis 		Cardiovascular Diseases 0.010 1.000 1 2017 2017
dbSNP: rs1188571702
rs1188571702 		1.000 0.080 1 173903962 missense variant A/G snv
CUI: C0272375
Disease: Antithrombin III Deficiency
Antithrombin III Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs121909560
rs121909560 		1.000 0.080 1 173909737 frameshift variant CT/- delins
CUI: C0272375
Disease: Antithrombin III Deficiency
Antithrombin III Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs121909561
rs121909561 		1.000 0.080 1 173909681 frameshift variant TCCA/- delins
CUI: C0272375
Disease: Antithrombin III Deficiency
Antithrombin III Deficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Hemic and Lymphatic Diseases 0.700 0