MYH11, myosin heavy chain 11, 4629

N. diseases: 161; N. variants: 25
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1057518938
rs1057518938 		0.882 0.080 16 15724166 missense variant C/G snv
CUI: C0026266
Disease: Mitral Valve Insufficiency
Mitral Valve Insufficiency 		Cardiovascular Diseases 0.700 0
dbSNP: rs1057518938
rs1057518938 		0.882 0.080 16 15724166 missense variant C/G snv
CUI: C0027092
Disease: Myopia
Myopia 		Eye Diseases 0.700 0
dbSNP: rs1057518938
rs1057518938 		0.882 0.080 16 15724166 missense variant C/G snv
CUI: C0344905
Disease: Left ventricular abnormality
Left ventricular abnormality 		0.700 0
dbSNP: rs1057518938
rs1057518938 		0.882 0.080 16 15724166 missense variant C/G snv
CUI: C1298820
Disease: Aneurysm of aortic root
Aneurysm of aortic root 		Cardiovascular Diseases 0.700 0
dbSNP: rs1057518938
rs1057518938 		0.882 0.080 16 15724166 missense variant C/G snv
CUI: C0040961
Disease: Tricuspid Valve Insufficiency
Tricuspid Valve Insufficiency 		Cardiovascular Diseases 0.700 0
dbSNP: rs1555459260
rs1555459260 		0.925 0.040 16 15838252 start lost T/C snv
CUI: C0002940
Disease: Aneurysm
Aneurysm 		Cardiovascular Diseases 0.700 0
dbSNP: rs1555459260
rs1555459260 		0.925 0.040 16 15838252 start lost T/C snv
CUI: C4707243
Disease: Familial thoracic aortic aneurysm and aortic dissection
Familial thoracic aortic aneurysm and aortic dissection 		0.700 0
dbSNP: rs1555554098
rs1555554098 		1.000 0.080 16 15726913 inframe deletion TGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCCGCAGCTCC/- delins
CUI: C1851504
Disease: Aortic aneurysm, familial thoracic 4
Aortic aneurysm, familial thoracic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1567692384
rs1567692384 		1.000 0.080 16 15719639 frameshift variant TT/- delins
CUI: C1851504
Disease: Aortic aneurysm, familial thoracic 4
Aortic aneurysm, familial thoracic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs267606902
rs267606902 		0.925 0.080 16 15748092 missense variant C/T snv
CUI: C4707243
Disease: Familial thoracic aortic aneurysm and aortic dissection
Familial thoracic aortic aneurysm and aortic dissection 		0.700 0
dbSNP: rs749497185
rs749497185 		1.000 0.080 16 15741512 frameshift variant CT/- del 4.0E-06
CUI: C1851504
Disease: Aortic aneurysm, familial thoracic 4
Aortic aneurysm, familial thoracic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs794728677
rs794728677 		1.000 16 15721419 splice donor variant -/A delins
CUI: C4707243
Disease: Familial thoracic aortic aneurysm and aortic dissection
Familial thoracic aortic aneurysm and aortic dissection 		0.700 0
dbSNP: rs797045725
rs797045725 		1.000 0.080 16 15735402 frameshift variant TCCAGCTCTGTCTTTAGGGCCTCCAGCTCCTCGCCGAGGTCTCGCTTCT/- delins
CUI: C1851504
Disease: Aortic aneurysm, familial thoracic 4
Aortic aneurysm, familial thoracic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs142546324
rs142546324 		1.000 0.080 16 15718337 missense variant C/T snv 1.7E-04 2.0E-04
CUI: C1851504
Disease: Aortic aneurysm, familial thoracic 4
Aortic aneurysm, familial thoracic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 6 2006 2017
dbSNP: rs397514037
rs397514037 		1.000 0.080 16 15721421 splice donor variant C/A;G;T snv
CUI: C1851504
Disease: Aortic aneurysm, familial thoracic 4
Aortic aneurysm, familial thoracic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 3 2006 2016
dbSNP: rs267606902
rs267606902 		0.925 0.080 16 15748092 missense variant C/T snv
CUI: C1851504
Disease: Aortic aneurysm, familial thoracic 4
Aortic aneurysm, familial thoracic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 1 2007 2007
dbSNP: rs17213965
rs17213965 		16 15788110 intron variant C/T snv 0.24
CUI: C0205682
Disease: Waist-Hip Ratio
Waist-Hip Ratio 		0.800 1.000 1 2013 2013
dbSNP: rs150759461
rs150759461 		16 15778831 missense variant G/A snv 1.7E-03 1.7E-03
CUI: C0020538
Disease: Hypertensive disease
Hypertensive disease 		Cardiovascular Diseases 0.010 1.000 1 2015 2015
dbSNP: rs786205435
rs786205435 		0.925 0.080 16 15732617 stop gained T/A snv
CUI: C0042781
Disease: Visceral Myopathy
Visceral Myopathy 		Digestive System Diseases 0.700 1.000 1 2015 2015
dbSNP: rs786205435
rs786205435 		0.925 0.080 16 15732617 stop gained T/A snv
CUI: C1608393
Disease: Megacystis microcolon intestinal hypoperistalsis syndrome
Megacystis microcolon intestinal hypoperistalsis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.010 1.000 1 2015 2015
dbSNP: rs3915499
rs3915499 		16 15816886 intron variant G/A snv 0.37
CUI: C1821417
Disease: RESTING HEART RATE
RESTING HEART RATE 		0.700 1.000 2 2016 2018
dbSNP: rs12923604
rs12923604 		1.000 0.040 16 15837513 intron variant G/A;T snv
CUI: C0023467
Disease: Leukemia, Myelocytic, Acute
Leukemia, Myelocytic, Acute 		Neoplasms 0.700 1.000 1 2017 2017
dbSNP: rs215570
rs215570 		1.000 0.040 16 15851172 intron variant C/T snv 0.48
CUI: C0023467
Disease: Leukemia, Myelocytic, Acute
Leukemia, Myelocytic, Acute 		Neoplasms 0.700 1.000 1 2017 2017
dbSNP: rs3851702
rs3851702 		1.000 0.040 16 15855705 intron variant T/C snv 0.19
CUI: C0023467
Disease: Leukemia, Myelocytic, Acute
Leukemia, Myelocytic, Acute 		Neoplasms 0.700 1.000 1 2017 2017
dbSNP: rs3851703
rs3851703 		1.000 0.040 16 15855790 intron variant G/A snv 0.19
CUI: C0023467
Disease: Leukemia, Myelocytic, Acute
Leukemia, Myelocytic, Acute 		Neoplasms 0.700 1.000 1 2017 2017