MYH11, myosin heavy chain 11, 4629

N. diseases: 161; N. variants: 25
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1555459260
rs1555459260 		0.925 0.040 16 15838252 start lost T/C snv
CUI: C4707243
Disease: Familial thoracic aortic aneurysm and aortic dissection
Familial thoracic aortic aneurysm and aortic dissection 		0.700 0
dbSNP: rs1555554098
rs1555554098 		1.000 0.080 16 15726913 inframe deletion TGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCCGCAGCTCC/- delins
CUI: C1851504
Disease: Aortic aneurysm, familial thoracic 4
Aortic aneurysm, familial thoracic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1567692384
rs1567692384 		1.000 0.080 16 15719639 frameshift variant TT/- delins
CUI: C1851504
Disease: Aortic aneurysm, familial thoracic 4
Aortic aneurysm, familial thoracic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs267606902
rs267606902 		0.925 0.080 16 15748092 missense variant C/T snv
CUI: C4707243
Disease: Familial thoracic aortic aneurysm and aortic dissection
Familial thoracic aortic aneurysm and aortic dissection 		0.700 0
dbSNP: rs749497185
rs749497185 		1.000 0.080 16 15741512 frameshift variant CT/- del 4.0E-06
CUI: C1851504
Disease: Aortic aneurysm, familial thoracic 4
Aortic aneurysm, familial thoracic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs794728677
rs794728677 		1.000 16 15721419 splice donor variant -/A delins
CUI: C4707243
Disease: Familial thoracic aortic aneurysm and aortic dissection
Familial thoracic aortic aneurysm and aortic dissection 		0.700 0
dbSNP: rs797045725
rs797045725 		1.000 0.080 16 15735402 frameshift variant TCCAGCTCTGTCTTTAGGGCCTCCAGCTCCTCGCCGAGGTCTCGCTTCT/- delins
CUI: C1851504
Disease: Aortic aneurysm, familial thoracic 4
Aortic aneurysm, familial thoracic 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs150759461
rs150759461 		16 15778831 missense variant G/A snv 1.7E-03 1.7E-03
CUI: C0003493
Disease: Aortic Diseases
Aortic Diseases 		Cardiovascular Diseases 0.020 1.000 2 2018 2018
dbSNP: rs150759461
rs150759461 		16 15778831 missense variant G/A snv 1.7E-03 1.7E-03
CUI: C0020538
Disease: Hypertensive disease
Hypertensive disease 		Cardiovascular Diseases 0.010 1.000 1 2015 2015
dbSNP: rs786205435
rs786205435 		0.925 0.080 16 15732617 stop gained T/A snv
CUI: C1608393
Disease: Megacystis microcolon intestinal hypoperistalsis syndrome
Megacystis microcolon intestinal hypoperistalsis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.010 1.000 1 2015 2015