MYO7A, myosin VIIA, 4647

N. diseases: 104; N. variants: 194
Disease: Usher Syndrome, Type I ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1060499716
rs1060499716 		1.000 0.200 11 77157397 splice region variant G/A snv 9.3E-06
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1060499800
rs1060499800 		0.925 0.200 11 77179069 frameshift variant C/- del
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1060499801
rs1060499801 		0.925 0.200 11 77211296 stop gained C/T snv
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs111033290
rs111033290 		0.925 0.200 11 77175465 splice donor variant G/A snv 2.0E-05 1.4E-05
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1188637368
rs1188637368 		0.925 0.200 11 77201488 frameshift variant C/- delins 8.0E-06
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1191025888
rs1191025888 		1.000 0.200 11 77213007 missense variant G/A snv
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1192104600
rs1192104600 		0.925 0.200 11 77202426 splice donor variant T/C snv
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1253943370
rs1253943370 		0.925 0.200 11 77189416 stop gained G/A snv
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1296612982
rs1296612982 		0.925 0.200 11 77181522 missense variant T/G snv
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1343207038
rs1343207038 		0.925 0.200 11 77172886 splice donor variant G/C snv 7.0E-06
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1480697910
rs1480697910 		0.925 0.200 11 77192233 frameshift variant CAGG/- delins 7.0E-06
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1555051567
rs1555051567 		0.925 0.200 11 77142805 splice donor variant GGATGATGAAGACAATGTGAGT/- delins
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1555061466
rs1555061466 		0.925 0.200 11 77155934 frameshift variant G/- del
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1555069238
rs1555069238 		1.000 0.200 11 77162125 missense variant A/T snv
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1555072299
rs1555072299 		0.925 0.200 11 77166054 splice acceptor variant A/G snv
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1555082041
rs1555082041 		0.925 0.200 11 77179039 splice acceptor variant AGGTCTAACTTTC/- delins
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1555085978
rs1555085978 		0.925 0.200 11 77183092 stop gained A/T snv
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1555090168
rs1555090168 		0.925 0.200 11 77189342 splice acceptor variant A/G snv
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1555090885
rs1555090885 		0.925 0.200 11 77190019 splice acceptor variant G/C snv
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1555091636
rs1555091636 		0.925 0.200 11 77190761 frameshift variant TGCTGACG/- del
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1555092993
rs1555092993 		0.925 0.200 11 77192144 frameshift variant G/CC delins
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1555093028
rs1555093028 		0.925 0.200 11 77192150 frameshift variant T/- del
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1555100200
rs1555100200 		0.925 0.200 11 77199541 frameshift variant C/- delins
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1555100273
rs1555100273 		0.925 0.200 11 77199608 frameshift variant C/- del
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1555100315
rs1555100315 		0.925 0.200 11 77199625 frameshift variant CT/- del
CUI: C1568247
Disease: Usher Syndrome, Type I
Usher Syndrome, Type I 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0