NBN, nibrin, 4683
N. diseases: 291; N. variants: 194
Source: ALL
Variant | DSI v | DPI v | Chr | Position | Consequence | Alleles | Class | AF EXOME | AF GENOME | Disease | Disease Class | Score vda | EI vda | N. PMIDs | First Ref. | Last Ref. | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
1.000 | 0.040 | 8 | 89937024 | splice donor variant | A/C | snv | 8.0E-06 | 7.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||
|
8 | 89946169 | stop gained | G/A | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||||
|
8 | 89946270 | frameshift variant | C/- | del |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||||
|
8 | 89953393 | frameshift variant | TTCCAATACTTCATCTTCTATGGCCACATCATCCATTTCCCTTTTTTTATTTGATCTTAGCTTTTCTGCAGCATGAGATTTACTG/- | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||||
|
8 | 89953506 | frameshift variant | A/- | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||||
|
8 | 89953534 | frameshift variant | -/T | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||||
|
8 | 89953587 | stop gained | C/T | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||||
|
1.000 | 0.040 | 8 | 89953690 | stop gained | C/A | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
8 | 89955314 | frameshift variant | T/- | del |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||||
|
8 | 89955344 | frameshift variant | C/- | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||||
|
8 | 89955494 | frameshift variant | G/- | del |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||||
|
1.000 | 0.040 | 8 | 89955509 | stop gained | G/A | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
8 | 89955530 | frameshift variant | T/- | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||||
|
8 | 89955557 | splice acceptor variant | T/C | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||||
|
1.000 | 0.040 | 8 | 89964409 | splice donor variant | C/A | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
1.000 | 0.040 | 8 | 89964487 | frameshift variant | G/- | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
8 | 89970416 | frameshift variant | T/-;TT | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||||
|
8 | 89970459 | frameshift variant | -/C | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||||
|
1.000 | 0.040 | 8 | 89971272 | frameshift variant | ATCAAGAGGTGGG/CAA | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
8 | 89978230 | stop gained | G/A | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||||
|
8 | 89978267 | frameshift variant | TTC/A | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||||
|
1.000 | 0.040 | 8 | 89980769 | frameshift variant | G/- | del |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
8 | 89980886 | frameshift variant | A/- | del |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||||
|
1.000 | 0.040 | 8 | 89982804 | frameshift variant | TTTCCTT/- | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
8 | 89958819 | frameshift variant | -/T | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 |