OAT, ornithine aminotransferase, 4942
N. diseases: 92; N. variants: 71
Source: ALL
Variant | DSI v | DPI v | Chr | Position | Consequence | Alleles | Class | AF EXOME | AF GENOME | Disease | Disease Class | Score vda | EI vda | N. PMIDs | First Ref. | Last Ref. | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
1.000 | 0.080 | 10 | 124412020 | missense variant | C/T | snv | 1.2E-05 | 7.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.700 | 0 | |||||||||
|
1.000 | 0.080 | 10 | 124411967 | splice donor variant | ACGTACCT/TTAA | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 10 | 124412119 | frameshift variant | -/CTCC | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 10 | 124408943 | splice acceptor variant | CTACATCCCATAAGTAAATACCTAAAATACATAAGAAAGGAAAATAATTTTAGACAATT/- | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 10 | 124398070 | stop gained | G/A | snv | 8.0E-06 | 7.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.700 | 0 | |||||||||
|
1.000 | 0.080 | 10 | 124412013 | frameshift variant | G/- | del | 4.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.700 | 0 | ||||||||||
|
1.000 | 0.080 | 10 | 124402930 | stop gained | G/C | snv | 1.6E-05 | 2.8E-05 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.700 | 1.000 | 2 | 1992 | 2012 | ||||||
|
1.000 | 0.080 | 10 | 124398057 | missense variant | A/C;G | snv | 4.0E-06; 2.7E-04 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.710 | 1.000 | 8 | 1988 | 2013 | |||||||
|
1.000 | 0.080 | 10 | 124401788 | missense variant | C/T | snv | 8.0E-06 | 1.4E-05 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.710 | 1.000 | 8 | 1988 | 2013 | ||||||
|
1.000 | 0.080 | 10 | 124412009 | missense variant | A/G | snv | 7.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.700 | 1.000 | 7 | 1988 | 2013 | |||||||
|
1.000 | 0.080 | 10 | 124408887 | missense variant | C/A | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.700 | 1.000 | 7 | 1988 | 2013 | ||||||||
|
0.851 | 0.160 | 10 | 124408601 | missense variant | C/A;T | snv | 8.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.700 | 1.000 | 7 | 1988 | 2013 | |||||||
|
1.000 | 0.080 | 10 | 124403019 | missense variant | C/G | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.700 | 1.000 | 7 | 1988 | 2013 | ||||||||
|
1.000 | 0.080 | 10 | 124403015 | missense variant | C/T | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.700 | 1.000 | 7 | 1988 | 2013 | ||||||||
|
1.000 | 0.080 | 10 | 124398012 | missense variant | G/A | snv | 2.0E-05 | 4.9E-05 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.800 | 1.000 | 7 | 1988 | 2013 | ||||||
|
1.000 | 0.080 | 10 | 124400875 | missense variant | C/G | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.700 | 1.000 | 7 | 1988 | 2013 | ||||||||
|
1.000 | 0.080 | 10 | 124403835 | missense variant | T/C | snv | 4.0E-06 | 1.4E-05 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.700 | 1.000 | 7 | 1988 | 2013 | ||||||
|
1.000 | 0.080 | 10 | 124412010 | missense variant | G/T | snv | 1.2E-05 | 1.4E-05 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.700 | 1.000 | 7 | 1988 | 2013 | ||||||
|
1.000 | 0.080 | 10 | 124401785 | missense variant | G/A | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.700 | 1.000 | 7 | 1988 | 2013 | ||||||||
|
1.000 | 0.080 | 10 | 124403847 | missense variant | G/A;C | snv | 3.6E-05 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.800 | 1.000 | 7 | 1988 | 2013 | |||||||
|
1.000 | 0.080 | 10 | 124403820 | missense variant | C/G;T | snv | 4.8E-05 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.700 | 1.000 | 7 | 1988 | 2013 | |||||||
|
1.000 | 0.080 | 10 | 124400941 | missense variant | C/T | snv | 4.0E-05 | 7.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.700 | 1.000 | 7 | 1988 | 2013 | ||||||
|
1.000 | 0.080 | 10 | 124398082 | missense variant | A/G | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.700 | 1.000 | 7 | 1988 | 2013 | ||||||||
|
0.925 | 0.080 | 10 | 124403892 | missense variant | G/A | snv | 1.6E-05 | 7.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.710 | 1.000 | 7 | 1988 | 2013 | ||||||
|
1.000 | 0.080 | 10 | 124408897 | missense variant | G/C | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases | 0.700 | 1.000 | 7 | 1988 | 2013 |