Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1064796049
rs1064796049
1.000 0.080 22 37983644 frameshift variant C/- delins
CUI: C2750452
Disease: Waardenburg Syndrome, Type 4c
Waardenburg Syndrome, Type 4c
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.700 0
dbSNP: rs121909117
rs121909117
1.000 0.080 22 37978094 missense variant G/A snv
CUI: C2750452
Disease: Waardenburg Syndrome, Type 4c
Waardenburg Syndrome, Type 4c
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.800 1.000 3 1998 2011
dbSNP: rs1373797370
rs1373797370
1.000 0.080 22 37978112 missense variant C/G;T snv
CUI: C2750452
Disease: Waardenburg Syndrome, Type 4c
Waardenburg Syndrome, Type 4c
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.700 0
dbSNP: rs1555937390
rs1555937390
1.000 0.080 22 37973789 frameshift variant G/- del
CUI: C2750452
Disease: Waardenburg Syndrome, Type 4c
Waardenburg Syndrome, Type 4c
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.700 0
dbSNP: rs1555937395
rs1555937395
1.000 0.080 22 37973800 frameshift variant -/C delins
CUI: C2750452
Disease: Waardenburg Syndrome, Type 4c
Waardenburg Syndrome, Type 4c
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.700 0
dbSNP: rs1555937400
rs1555937400
1.000 0.080 22 37973806 stop gained G/A snv
CUI: C2750452
Disease: Waardenburg Syndrome, Type 4c
Waardenburg Syndrome, Type 4c
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.700 0
dbSNP: rs1555937463
rs1555937463
1.000 0.080 22 37973961 frameshift variant -/T delins
CUI: C2750452
Disease: Waardenburg Syndrome, Type 4c
Waardenburg Syndrome, Type 4c
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.700 0
dbSNP: rs1555939403
rs1555939403
1.000 0.080 22 37983359 stop gained C/G;T snv
CUI: C2750452
Disease: Waardenburg Syndrome, Type 4c
Waardenburg Syndrome, Type 4c
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.700 0
dbSNP: rs1555939421
rs1555939421
1.000 0.080 22 37983404 frameshift variant -/G delins
CUI: C2750452
Disease: Waardenburg Syndrome, Type 4c
Waardenburg Syndrome, Type 4c
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.700 0
dbSNP: rs1555939426
rs1555939426
1.000 0.080 22 37983421 missense variant G/C snv
CUI: C2750452
Disease: Waardenburg Syndrome, Type 4c
Waardenburg Syndrome, Type 4c
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.700 0
dbSNP: rs1555939459
rs1555939459
1.000 0.080 22 37983484 stop gained T/A snv
CUI: C2750452
Disease: Waardenburg Syndrome, Type 4c
Waardenburg Syndrome, Type 4c
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.700 0
dbSNP: rs1555939460
rs1555939460
1.000 0.080 22 37983485 frameshift variant GCT/CC delins
CUI: C2750452
Disease: Waardenburg Syndrome, Type 4c
Waardenburg Syndrome, Type 4c
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.700 0
dbSNP: rs1555939476
rs1555939476
1.000 0.080 22 37983510 frameshift variant -/GGGCATGGGCACCAGCGTCC delins
CUI: C2750452
Disease: Waardenburg Syndrome, Type 4c
Waardenburg Syndrome, Type 4c
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.700 0
dbSNP: rs1555939523
rs1555939523
1.000 0.080 22 37983658 stop gained G/A snv
CUI: C2750452
Disease: Waardenburg Syndrome, Type 4c
Waardenburg Syndrome, Type 4c
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.700 0
dbSNP: rs1569167586
rs1569167586
0.851 0.160 22 37973687 frameshift variant AGTAG/- delins
CUI: C2750452
Disease: Waardenburg Syndrome, Type 4c
Waardenburg Syndrome, Type 4c
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.700 0
dbSNP: rs281797260
rs281797260
1.000 0.080 22 37977943 stop gained G/C snv
CUI: C2750452
Disease: Waardenburg Syndrome, Type 4c
Waardenburg Syndrome, Type 4c
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.700 0
dbSNP: rs397515366
rs397515366
1.000 0.080 22 37978081 inframe insertion -/AGGAGC ins
CUI: C2750452
Disease: Waardenburg Syndrome, Type 4c
Waardenburg Syndrome, Type 4c
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.700 0
dbSNP: rs397515367
rs397515367
1.000 0.080 22 37973818 frameshift variant CT/- delins
CUI: C2750452
Disease: Waardenburg Syndrome, Type 4c
Waardenburg Syndrome, Type 4c
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.700 0
dbSNP: rs73415876
rs73415876
1.000 0.080 22 37983536 stop gained G/A;C;T snv 9.2E-03
CUI: C2750452
Disease: Waardenburg Syndrome, Type 4c
Waardenburg Syndrome, Type 4c
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.700 0
dbSNP: rs74315514
rs74315514
0.925 0.280 22 37977999 stop gained C/A snv
CUI: C2750452
Disease: Waardenburg Syndrome, Type 4c
Waardenburg Syndrome, Type 4c
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.700 0
dbSNP: rs74315520
rs74315520
0.925 0.280 22 37973767 stop gained G/A snv
CUI: C2750452
Disease: Waardenburg Syndrome, Type 4c
Waardenburg Syndrome, Type 4c
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.700 0
dbSNP: rs763210407
rs763210407
1.000 0.080 22 37977978 stop gained C/A;G;T snv 1.6E-05; 6.9E-05
CUI: C2750452
Disease: Waardenburg Syndrome, Type 4c
Waardenburg Syndrome, Type 4c
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases 0.700 0