Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1114167302
rs1114167302
0.925 0.320 17 58216687 missense variant C/A snv
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.010 1.000 1 2016 2016
dbSNP: rs1376664664
rs1376664664
0.882 0.320 17 58214739 splice donor variant A/C;G snv 4.1E-06
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1488635637
rs1488635637
0.827 0.360 17 58208003 splice acceptor variant T/C;G snv 7.0E-06
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1555596845
rs1555596845
0.882 0.320 17 58206493 frameshift variant GTGACAGTGCCTGTGGTCTCTGTGCGGAG/- delins
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1555596943
rs1555596943
0.882 0.320 17 58206549 splice acceptor variant T/C snv
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1555599412
rs1555599412
0.827 0.320 17 58213011 stop gained C/A snv
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 1.000 1 2011 2011
dbSNP: rs1555601787
rs1555601787
0.882 0.320 17 58219230 start lost T/C snv
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs199874059
rs199874059
0.882 0.320 17 58210658 splice donor variant C/T snv 6.0E-05 2.1E-05
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 1.000 1 2007 2007
dbSNP: rs201845154
rs201845154
1.000 0.320 17 58214760 missense variant G/A snv 1.8E-04 3.4E-04
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 1.000 3 2006 2016
dbSNP: rs201933838
rs201933838
0.882 0.320 17 58214740 splice donor variant C/T snv 1.2E-05
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 1.000 1 2007 2007
dbSNP: rs375170572
rs375170572
0.827 0.320 17 58218618 splice donor variant A/G snv 3.2E-05 3.5E-05
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs386834043
rs386834043
0.851 0.320 17 58206553 splice region variant ATGCCATTGGGACAGCCTCAGGTTTCTGC/- delins 1.3E-03
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs386834044
rs386834044
0.851 0.320 17 58206501 frameshift variant -/CCTG delins 7.2E-05 7.0E-06
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 1.000 1 2007 2007
dbSNP: rs386834046
rs386834046
0.882 0.320 17 58218620 frameshift variant AGTTGGC/- delins
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 1.000 1 2007 2007
dbSNP: rs386834048
rs386834048
0.827 0.320 17 58216088 splice region variant C/T snv 1.3E-04 1.3E-04
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 1.000 4 2007 2015
dbSNP: rs386834051
rs386834051
0.882 0.320 17 58219175 frameshift variant -/CCCGG delins 6.6E-06
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 1.000 1 2006 2006
dbSNP: rs386834052
rs386834052
0.882 0.320 17 58219149 splice donor variant A/G snv
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 1.000 1 2006 2006
dbSNP: rs386834053
rs386834053
0.925 0.320 17 58210980 missense variant C/T snv 2.0E-05 2.1E-05
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs730880323
rs730880323
1.000 0.320 17 58219176 frameshift variant -/CCGGG delins
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs754279998
rs754279998
0.776 0.360 17 58208153 inframe deletion GAG/- delins 2.0E-05 1.4E-05
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 1.000 3 2014 2016
dbSNP: rs756102768
rs756102768
0.882 0.320 17 58212981 splice donor variant C/G;T snv 4.0E-06; 4.0E-06
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs756853299
rs756853299
0.882 0.320 17 58214748 stop gained G/A snv 8.2E-06
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs762668200
rs762668200
0.882 0.320 17 58206543 splice acceptor variant -/C delins 6.5E-05 7.0E-06
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs773684291
rs773684291
0.925 0.320 17 58207959 missense variant G/A;C snv 8.0E-06; 4.0E-06
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs775043799
rs775043799
0.882 0.320 17 58216137 frameshift variant -/G delins
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0