PTCH1, patched 1, 5727

N. diseases: 604; N. variants: 194
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs368869806
rs368869806
0.614 0.480 9 95485875 splice acceptor variant C/T snv 4.0E-06 7.0E-06
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.700 0
dbSNP: rs755103500
rs755103500
0.851 0.160 9 95516820 start lost T/C;G snv 8.4E-06; 4.2E-06
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.010 1.000 1 2009 2009
dbSNP: rs766905791
rs766905791
0.851 0.160 9 95485815 start lost T/C snv 1.2E-05
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.010 1.000 1 2009 2009
dbSNP: rs587776689
rs587776689
0.882 0.160 9 95453587 missense variant T/A;G snv
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.700 1.000 5 1996 2004
dbSNP: rs1131690985
rs1131690985
0.925 0.200 9 95449891 missense variant C/T snv
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.010 1.000 1 2000 2000
dbSNP: rs1249050389
rs1249050389
0.925 0.240 9 95485696 stop gained G/C snv
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.010 1.000 1 2018 2018
dbSNP: rs1564032829
rs1564032829
0.925 0.160 9 95468757 frameshift variant T/- delins
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.700 0
dbSNP: rs863225055
rs863225055
0.925 0.160 9 95476760 frameshift variant AAAAGGGATTC/- delins
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.700 0
dbSNP: rs878853856
rs878853856
1.000 0.160 9 95453533 missense variant A/G snv
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.800 1.000 8 1996 2015
dbSNP: rs1060502268
rs1060502268
1.000 0.160 9 95476835 missense variant C/T snv
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.700 1.000 4 2003 2013
dbSNP: rs1554698582
rs1554698582
1.000 0.160 9 95477618 inframe deletion ACCAGCAGGACGCCA/- delins
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.700 1.000 4 1996 2006
dbSNP: rs1060502292
rs1060502292
1.000 0.160 9 95468803 frameshift variant AG/- delins
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.700 1.000 3 1997 2006
dbSNP: rs1064793921
rs1064793921
1.000 0.160 9 95476161 splice acceptor variant T/C;G snv
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.700 1.000 3 2006 2014
dbSNP: rs1131690986
rs1131690986
1.000 0.160 9 95485866 stop gained G/A snv
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.700 1.000 3 1997 2006
dbSNP: rs863224443
rs863224443
1.000 0.160 9 95449942 splice acceptor variant T/C snv
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.700 1.000 3 2005 2006
dbSNP: rs1060502277
rs1060502277
1.000 0.160 9 95476758 splice donor variant C/A;T snv
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.700 1.000 2 2006 2006
dbSNP: rs1554695039
rs1554695039
1.000 0.160 9 95468939 stop gained G/A snv
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.700 1.000 2 1997 2012
dbSNP: rs1554698613
rs1554698613
1.000 0.160 9 95477680 splice acceptor variant TTAGACAGGCATAGGCGAGCTGCAAGCAGAACAATGG/- delins
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.700 1.000 2 2006 2006
dbSNP: rs1554700574
rs1554700574
1.000 0.160 9 95481948 splice donor variant CAGGAGG/- del
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.700 1.000 2 2006 2006
dbSNP: rs1554708760
rs1554708760
1.000 0.160 9 95506541 frameshift variant AA/- del
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.700 1.000 2 1997 2006
dbSNP: rs864622212
rs864622212
1.000 0.160 9 95506542 frameshift variant AG/- delins
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.700 1.000 2 1997 2006
dbSNP: rs878853849
rs878853849
1.000 0.160 9 95506601 splice acceptor variant T/C;G snv
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.700 1.000 2 2006 2006
dbSNP: rs878853852
rs878853852
1.000 0.160 9 95462000 splice acceptor variant T/A;C snv
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.700 1.000 2 2006 2006
dbSNP: rs1131690987
rs1131690987
1.000 0.160 9 95480449 frameshift variant A/- del
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.700 1.000 1 1998 1998
dbSNP: rs1554697928
rs1554697928
1.000 0.160 9 95476110 frameshift variant -/T delins
CUI: C0004779
Disease: Basal Cell Nevus Syndrome
Basal Cell Nevus Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Musculoskeletal Diseases; Stomatognathic Diseases 0.700 1.000 1 1997 1997