Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs587780021
rs587780021
0.878 0.179 2 214745842 stop gained G/A snp 2.4E-05 3.2E-05
Hereditary Breast and Ovarian Cancer Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Endocrine System Diseases; Female Urogenital Diseases and Pregnancy Complications; Neoplasms; Skin and Connective Tissue Diseases 0.700 7 2012 2016
dbSNP: rs587780024
rs587780024
0.923 0.179 2 214730457 frameshift variant T/TCATACTTTTCTTCCTGTTCA in-del 6.4E-05 3.2E-05
Hereditary Breast and Ovarian Cancer Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Endocrine System Diseases; Female Urogenital Diseases and Pregnancy Complications; Neoplasms; Skin and Connective Tissue Diseases 0.700 2 2010 2012
dbSNP: rs879254139
rs879254139
0.923 0.179 2 214797118 splice acceptor variant C/A snp
Hereditary Breast and Ovarian Cancer Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Endocrine System Diseases; Female Urogenital Diseases and Pregnancy Complications; Neoplasms; Skin and Connective Tissue Diseases 0.700 0