Disease: Cerebellar Ataxia ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs863224229
rs863224229 		0.925 0.200 9 133356441 start lost ACCGCCGCCATCGCACCCGGCCCC/- delins
CUI: C0007758
Disease: Cerebellar Ataxia
Cerebellar Ataxia 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases 0.700 1.000 1 2016 2016
dbSNP: rs781934508
rs781934508 		1.000 0.080 9 133352441 splice region variant C/A;T snv 2.4E-05
CUI: C0007758
Disease: Cerebellar Ataxia
Cerebellar Ataxia 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases 0.700 0
dbSNP: rs782316919
rs782316919 		0.827 0.160 9 133351970 frameshift variant AG/- delins 8.4E-05
CUI: C0007758
Disease: Cerebellar Ataxia
Cerebellar Ataxia 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases 0.700 0