UBE3A, ubiquitin protein ligase E3A, 7337

N. diseases: 155; N. variants: 125
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1057518770
rs1057518770 		1.000 15 25354536 missense variant C/T snv
CUI: C0557874
Disease: Global developmental delay
Global developmental delay 		0.700 0
dbSNP: rs1057518770
rs1057518770 		1.000 15 25354536 missense variant C/T snv
CUI: C1842581
Disease: Abnormal corpus callosum morphology
Abnormal corpus callosum morphology 		Pathological Conditions, Signs and Symptoms 0.700 0
dbSNP: rs1057518770
rs1057518770 		1.000 15 25354536 missense variant C/T snv
CUI: C0454641
Disease: Expressive language delay
Expressive language delay 		0.700 0
dbSNP: rs1057518770
rs1057518770 		1.000 15 25354536 missense variant C/T snv
CUI: C0151611
Disease: Electroencephalogram abnormal
Electroencephalogram abnormal 		Nervous System Diseases 0.700 0
dbSNP: rs1057518770
rs1057518770 		1.000 15 25354536 missense variant C/T snv
CUI: C1848207
Disease: Poor speech
Poor speech 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases 0.700 0
dbSNP: rs1057518770
rs1057518770 		1.000 15 25354536 missense variant C/T snv
CUI: C0036572
Disease: Seizures
Seizures 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases 0.700 0
dbSNP: rs1057518777
rs1057518777 		15 25339239 splice acceptor variant -/TGAGATGTAGGTA delins
CUI: C0424605
Disease: Developmental delay (disorder)
Developmental delay (disorder) 		Mental Disorders 0.700 0
dbSNP: rs1057518777
rs1057518777 		15 25339239 splice acceptor variant -/TGAGATGTAGGTA delins
CUI: C1843367
Disease: Poor school performance
Poor school performance 		0.700 0
dbSNP: rs1057519062
rs1057519062 		1.000 0.080 15 25339187 frameshift variant TAAGTTTTTCTTTGCTT/- delins
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1064792950
rs1064792950 		1.000 0.080 15 25339205 frameshift variant TTGAGTATTCCGGAAGT/- del
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1064795012
rs1064795012 		1.000 0.080 15 25370597 missense variant C/T snv
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs111033594
rs111033594 		1.000 0.080 15 25370865 stop gained G/A;C snv 4.0E-06
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs111033595
rs111033595 		1.000 0.080 15 25340219 stop gained C/T snv
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs111033596
rs111033596 		1.000 0.080 15 25371798 missense variant T/G snv
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs111033597
rs111033597 		1.000 0.080 15 25371725 missense variant A/G snv
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1555379800
rs1555379800 		1.000 0.080 15 25339188 frameshift variant -/AAGTT delins
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1555393242
rs1555393242 		1.000 0.080 15 25360440 missense variant C/T snv
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1566954070
rs1566954070 		1.000 0.080 15 25370574 frameshift variant G/- del
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1566959617
rs1566959617 		1.000 0.080 15 25371320 missense variant A/G snv
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs587781230
rs587781230 		1.000 0.080 15 25339189 frameshift variant -/TAAGTTTTTCTTTGCTTGAGTATTCCGGAAGTAAAAGCACATTA delins 4.0E-06
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs587782919
rs587782919 		1.000 0.080 15 25356827 missense variant T/C;G snv
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs587783097
rs587783097 		1.000 0.080 15 25339193 missense variant G/A snv
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs587784508
rs587784508 		1.000 0.080 15 25371024 stop gained C/A;T snv
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs587784509
rs587784509 		1.000 0.080 15 25371001 frameshift variant CATT/- delins
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs587784512
rs587784512 		1.000 0.080 15 25370766 frameshift variant CT/- delins
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0