CLRN1, clarin 1, 7401

N. diseases: 77; N. variants: 26
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs111033267
rs111033267
0.851 0.200 3 150972520 stop gained G/A;T snv 1.2E-05; 1.2E-05
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.710 1.000 4 2002 2014
dbSNP: rs374963432
rs374963432
1.000 0.200 3 150941647 stop gained G/T snv 1.6E-05 1.7E-04
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 1.000 3 2007 2012
dbSNP: rs121908140
rs121908140
1.000 0.200 3 150928107 stop gained A/C;G;T snv 6.8E-04; 4.0E-06
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 1.000 2 2001 2009
dbSNP: rs373208120
rs373208120
1.000 0.200 3 150928016 stop gained G/A snv 2.8E-05 1.4E-05
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 1.000 2 2012 2012
dbSNP: rs1057517224
rs1057517224
1.000 0.200 3 150972696 stop gained G/A;T snv 4.0E-06
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1553776052
rs1553776052
1.000 0.200 3 150972525 stop gained G/A snv
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1553776112
rs1553776112
1.000 0.200 3 150972669 stop gained C/A;T snv
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs376155416
rs376155416
1.000 0.200 3 150928094 stop gained G/A;T snv 4.0E-06
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs111033258
rs111033258
0.851 0.200 3 150972565 missense variant A/C snv 2.7E-04 1.5E-04
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.820 1.000 14 2001 2016
dbSNP: rs121908141
rs121908141
1.000 0.200 3 150941656 missense variant A/G;T snv 8.0E-06; 2.8E-05
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.800 1.000 7 2001 2012
dbSNP: rs121908142
rs121908142
1.000 0.200 3 150928186 missense variant A/G snv
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.800 1.000 7 2001 2012
dbSNP: rs121908143
rs121908143
0.827 0.200 3 150972591 missense variant A/C;G snv 8.0E-05; 4.0E-06
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.810 1.000 6 2001 2012
dbSNP: rs775098953
rs775098953
0.925 0.200 3 150928174 missense variant A/C snv 4.0E-06
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.010 1.000 1 2011 2011
dbSNP: rs1559982739
rs1559982739
1.000 0.200 3 150941692 missense variant A/G snv
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1057516687
rs1057516687
1.000 0.200 3 150941579 splice donor variant -/A delins 4.0E-06
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs786204428
rs786204428
1.000 0.200 3 150972557 frameshift variant CCTG/ATTGGACA delins
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 1.000 5 2002 2012
dbSNP: rs397517932
rs397517932
1.000 0.200 3 150941710 frameshift variant GACAT/- delins 8.0E-06
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 1.000 1 2011 2011
dbSNP: rs746523071
rs746523071
1.000 0.200 3 150928132 frameshift variant -/T delins 1.2E-05; 4.0E-06 7.0E-06
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 1.000 1 2007 2007
dbSNP: rs1553772595
rs1553772595
1.000 0.200 3 150941643 frameshift variant A/- delins
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1553776036
rs1553776036
1.000 0.200 3 150972499 frameshift variant CCTCTCCGTGGAAAAGCCCGTAC/- delins
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1553776061
rs1553776061
1.000 0.200 3 150972555 frameshift variant GCCC/- del
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1553776132
rs1553776132
1.000 0.200 3 150972706 start lost C/T snv
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1553776135
rs1553776135
1.000 0.200 3 150972707 start lost A/G snv
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0
dbSNP: rs1085307049
rs1085307049
1.000 0.200 3 150928174 inframe deletion ATA/- delins
CUI: C1568248
Disease: Usher Syndrome, Type III
Usher Syndrome, Type III
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 0