SBF2, SET binding factor 2, 81846

N. diseases: 77; N. variants: 78
Disease: Charcot-Marie-Tooth disease type 4 ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1564872328
rs1564872328 		1.000 0.080 11 9807999 splice donor variant C/T snv
CUI: C4082197
Disease: Charcot-Marie-Tooth disease type 4
Charcot-Marie-Tooth disease type 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 3 2003 2014
dbSNP: rs752649372
rs752649372 		1.000 0.080 11 9989597 splice acceptor variant T/C snv 4.1E-06
CUI: C4082197
Disease: Charcot-Marie-Tooth disease type 4
Charcot-Marie-Tooth disease type 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 2 2003 2014
dbSNP: rs1060499999
rs1060499999 		1.000 0.080 11 9787633 splice donor variant C/T snv 4.0E-06
CUI: C4082197
Disease: Charcot-Marie-Tooth disease type 4
Charcot-Marie-Tooth disease type 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1060500001
rs1060500001 		1.000 0.080 11 9853539 splice donor variant C/T snv
CUI: C4082197
Disease: Charcot-Marie-Tooth disease type 4
Charcot-Marie-Tooth disease type 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1270869520
rs1270869520 		1.000 0.080 11 10294049 frameshift variant GT/- del 7.0E-06
CUI: C4082197
Disease: Charcot-Marie-Tooth disease type 4
Charcot-Marie-Tooth disease type 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1564923441
rs1564923441 		1.000 0.080 11 9858375 stop gained G/A snv
CUI: C4082197
Disease: Charcot-Marie-Tooth disease type 4
Charcot-Marie-Tooth disease type 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1565115957
rs1565115957 		1.000 0.080 11 10000952 frameshift variant CAATAATGAAAGGCGTTGGGGAACTTAGAACTTCCAGTAGCTGAGCCGGGAGAATAGGGATATAAGGATA/- del
CUI: C4082197
Disease: Charcot-Marie-Tooth disease type 4
Charcot-Marie-Tooth disease type 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs774667470
rs774667470 		1.000 0.080 11 9832350 stop gained G/A snv 1.2E-05 7.0E-06
CUI: C4082197
Disease: Charcot-Marie-Tooth disease type 4
Charcot-Marie-Tooth disease type 4 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0