Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs74315450
rs74315450
0.851 0.120 21 34859485 missense variant C/T snv
Platelet Disorder, Familial, with Associated Myeloid Malignancy
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Hemic and Lymphatic Diseases 0.800 1.000 9 1999 2017
dbSNP: rs1060499616
rs1060499616
1.000 0.120 21 34880568 missense variant C/T snv
Platelet Disorder, Familial, with Associated Myeloid Malignancy
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Hemic and Lymphatic Diseases 0.800 1.000 6 1999 2018
dbSNP: rs1057519748
rs1057519748
0.827 0.120 21 34859486 stop gained G/A snv
Platelet Disorder, Familial, with Associated Myeloid Malignancy
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Hemic and Lymphatic Diseases 0.700 1.000 4 1999 2017
dbSNP: rs121912498
rs121912498
1.000 0.120 21 34886866 missense variant T/C snv
Platelet Disorder, Familial, with Associated Myeloid Malignancy
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Hemic and Lymphatic Diseases 0.700 1.000 3 2002 2013
dbSNP: rs267607026
rs267607026
1.000 0.120 21 34880598 missense variant G/T snv
Platelet Disorder, Familial, with Associated Myeloid Malignancy
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Hemic and Lymphatic Diseases 0.700 1.000 2 2009 2016
dbSNP: rs74315451
rs74315451
1.000 0.120 21 34880665 missense variant C/G snv
Platelet Disorder, Familial, with Associated Myeloid Malignancy
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Hemic and Lymphatic Diseases 0.700 1.000 2 2002 2013
dbSNP: rs121912499
rs121912499
1.000 0.120 21 34799407 stop gained G/T snv
Platelet Disorder, Familial, with Associated Myeloid Malignancy
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Hemic and Lymphatic Diseases 0.700 1.000 1 2002 2002
dbSNP: rs1555884790
rs1555884790
1.000 0.120 21 34792164 frameshift variant -/CG delins
Platelet Disorder, Familial, with Associated Myeloid Malignancy
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Hemic and Lymphatic Diseases 0.700 1.000 1 2012 2012
dbSNP: rs1555889984
rs1555889984
0.925 0.120 21 34834536 stop gained C/A snv
Platelet Disorder, Familial, with Associated Myeloid Malignancy
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Hemic and Lymphatic Diseases 0.700 1.000 1 2019 2019
dbSNP: rs1555899735
rs1555899735
1.000 0.120 21 34886878 missense variant A/T snv
Platelet Disorder, Familial, with Associated Myeloid Malignancy
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Hemic and Lymphatic Diseases 0.700 1.000 1 2015 2015
dbSNP: rs1569002296
rs1569002296
1.000 0.120 21 34792415 stop gained G/T snv
Platelet Disorder, Familial, with Associated Myeloid Malignancy
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Hemic and Lymphatic Diseases 0.700 1.000 1 2010 2010
dbSNP: rs1569061768
rs1569061768
1.000 0.120 21 34859477 stop gained G/A snv
Platelet Disorder, Familial, with Associated Myeloid Malignancy
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Hemic and Lymphatic Diseases 0.700 1.000 1 1999 1999
dbSNP: rs587776809
rs587776809
1.000 0.120 21 34880714 splice acceptor variant C/A;T snv
Platelet Disorder, Familial, with Associated Myeloid Malignancy
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Hemic and Lymphatic Diseases 0.700 1.000 1 2015 2015
dbSNP: rs587776810
rs587776810
1.000 0.120 21 34880554 splice region variant T/- del
Platelet Disorder, Familial, with Associated Myeloid Malignancy
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Hemic and Lymphatic Diseases 0.700 1.000 1 2002 2002
dbSNP: rs587776811
rs587776811
1.000 0.120 21 34880616 frameshift variant GCTGCGGT/- del
Platelet Disorder, Familial, with Associated Myeloid Malignancy
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Hemic and Lymphatic Diseases 0.700 1.000 1 2016 2016
dbSNP: rs895580593
rs895580593
1.000 0.120 21 34792596 missense variant T/A;C;G snv 4.9E-06
Platelet Disorder, Familial, with Associated Myeloid Malignancy
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Hemic and Lymphatic Diseases 0.010 1.000 1 2019 2019
dbSNP: rs1060502579
rs1060502579
1.000 0.120 21 34886842 splice donor variant C/G;T snv
Platelet Disorder, Familial, with Associated Myeloid Malignancy
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs1555899813
rs1555899813
1.000 0.120 21 34886977 frameshift variant -/CC delins
Platelet Disorder, Familial, with Associated Myeloid Malignancy
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs1569084116
rs1569084116
1.000 0.120 21 34886880 missense variant T/G snv
Platelet Disorder, Familial, with Associated Myeloid Malignancy
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs1569084530
rs1569084530
1.000 0.120 21 34887000 frameshift variant -/GGCGTCCGGGGCGCCCAGCGGCAACGCC delins
Platelet Disorder, Familial, with Associated Myeloid Malignancy
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Hemic and Lymphatic Diseases 0.700 0