Variant | DSI v | DPI v | Chr | Position | Consequence | Alleles | Class | AF EXOME | AF GENOME | Disease | Disease Class | Score vda | EI vda | N. PMIDs | First Ref. | Last Ref. | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
0.882 | 0.080 | 2 | 50420809 | intron variant | C/A;G;T | snv |
|
Neoplasms; Respiratory Tract Diseases | 0.010 | 1.000 | 1 | 2013 | 2013 | ||||||||
|
0.882 | 0.080 | 2 | 50420809 | intron variant | C/A;G;T | snv |
|
Neoplasms; Respiratory Tract Diseases | 0.010 | 1.000 | 1 | 2013 | 2013 | ||||||||
|
0.882 | 0.080 | 2 | 50420809 | intron variant | C/A;G;T | snv |
|
Neoplasms; Respiratory Tract Diseases | 0.010 | 1.000 | 1 | 2013 | 2013 | ||||||||
|
1.000 | 0.040 | 2 | 49921834 | 3 prime UTR variant | C/T | snv | 0.15 |
|
Mental Disorders | 0.010 | < 0.001 | 1 | 2011 | 2011 | |||||||
|
1.000 | 0.040 | 2 | 51020519 | intron variant | T/C | snv | 0.14 |
|
Mental Disorders | 0.010 | 1.000 | 1 | 2014 | 2014 | |||||||
|
1.000 | 0.040 | 2 | 50908336 | intron variant | C/T | snv | 0.26 |
|
Mental Disorders | 0.010 | 1.000 | 1 | 2011 | 2011 | |||||||
|
1.000 | 0.080 | 2 | 50443116 | intron variant | C/A;T | snv |
|
Chemically-Induced Disorders; Mental Disorders | 0.010 | 1.000 | 1 | 2016 | 2016 | ||||||||
|
1.000 | 0.040 | 2 | 50472460 | missense variant | T/C | snv | 4.0E-05 | 4.2E-05 |
|
Mental Disorders | 0.010 | < 0.001 | 1 | 2011 | 2011 | ||||||
|
1.000 | 0.040 | 2 | 51015132 | intron variant | A/G | snv | 9.2E-02 |
|
Mental Disorders | 0.010 | 1.000 | 1 | 2014 | 2014 | |||||||
|
1.000 | 0.040 | 2 | 51020156 | intron variant | T/C | snv | 0.27 |
|
Mental Disorders | 0.010 | 1.000 | 1 | 2011 | 2011 | |||||||
|
1.000 | 0.080 | 2 | 50063015 | intron variant | A/G;T | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases | 0.010 | 1.000 | 1 | 2018 | 2018 | ||||||||
|
1.000 | 0.040 | 2 | 51024999 | intron variant | A/C;G | snv | 0.23 |
|
Mental Disorders | 0.010 | 1.000 | 1 | 2011 | 2011 | |||||||
|
1.000 | 0.040 | 2 | 50924881 | intron variant | A/G | snv | 0.34 |
|
Mental Disorders | 0.010 | 1.000 | 1 | 2011 | 2011 | |||||||
|
1.000 | 0.040 | 2 | 50623548 | synonymous variant | G/A | snv | 2.5E-02 | 1.8E-02 |
|
Mental Disorders | 0.010 | 1.000 | 1 | 2012 | 2012 | ||||||
|
1.000 | 0.040 | 2 | 50531232 | missense variant | T/C | snv | 8.1E-06 |
|
Mental Disorders | 0.010 | 1.000 | 1 | 2019 | 2019 | |||||||
|
0.925 | 0.040 | 2 | 50552821 | missense variant | G/A | snv |
|
Mental Disorders | 0.010 | 1.000 | 1 | 2004 | 2004 | ||||||||
|
0.925 | 0.040 | 2 | 50552821 | missense variant | G/A | snv |
|
Mental Disorders | 0.010 | 1.000 | 1 | 2004 | 2004 | ||||||||
|
0.925 | 0.040 | 2 | 50552821 | missense variant | G/A | snv |
|
Mental Disorders | 0.010 | 1.000 | 1 | 2004 | 2004 | ||||||||
|
2 | 50109355 | intron variant | C/A | snv | 0.23 |
|
0.010 | 1.000 | 1 | 2012 | 2012 | ||||||||||
|
1.000 | 2 | 51026369 | splice donor variant | A/G | snv | 7.0E-06 |
|
0.700 | 1.000 | 3 | 2009 | 2014 | |||||||||
|
1.000 | 2 | 51026470 | splice acceptor variant | C/T | snv | 9.2E-06 | 3.5E-05 |
|
0.700 | 1.000 | 3 | 2009 | 2014 | ||||||||
|
1.000 | 0.040 | 2 | 50925810 | splice acceptor variant | CACAATCCAGAAACCAACAAATGTTCAGAAAGAAGTTCAACTTACCATCTAACTTCAAGATGTACCCTATTAGTACTAAGAAATAAAGGACAAATGAGAGTTGGAAAAATAAGGTAGAAAGCACCCACCTTCCACATTGTTGTCTTCTGAAAGCACATGACAAGGAGGGAGAGAAAAGGAAAAACATTCATTAAGCAGCATGCAGACTGGACCTTGCCTTTGCATGTCTTCCTCATGCAAGGCACCAAACACATCATGCAAGTGCTCCATCACTATCATTCAAGGGGGAAAACAAAATCACAGGGAAGCAGGTTCCCTCCCATTGGCAGCATTGATAGGAAGTGAGACAAACTTTCATAATACTGCCATGCCCTGTGCAAAGAGTTTTTAAAAAAATCTTTCAACTACCCAGTATAAAGCAAACATTATTGTTATTACATGTTGCTGGTG/- | del |
|
Behavior and Behavior Mechanisms | 0.700 | 1.000 | 2 | 2012 | 2013 | ||||||||
|
2 | 49973972 | missense variant | A/G | snv | 0.85 | 0.82 |
|
0.700 | 1.000 | 2 | 2019 | 2019 | |||||||||
|
2 | 50521617 | intron variant | G/A;C | snv |
|
Behavior and Behavior Mechanisms | 0.700 | 1.000 | 1 | 2015 | 2015 | ||||||||||
|
2 | 50521617 | intron variant | G/A;C | snv |
|
Behavior and Behavior Mechanisms | 0.700 | 1.000 | 1 | 2015 | 2015 |