Disease: Epilepsy, Partial, with Variable Foci ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs587776973
rs587776973 		0.925 0.040 22 31815209 stop gained C/G;T snv 4.0E-06
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.700 1.000 3 2013 2017
dbSNP: rs1060501488
rs1060501488 		1.000 0.040 22 31778119 stop gained G/A snv
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.700 1.000 2 2013 2016
dbSNP: rs1555885023
rs1555885023 		1.000 0.040 22 31814991 splice acceptor variant G/T snv
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.700 1.000 2 2013 2013
dbSNP: rs587776975
rs587776975 		0.925 0.040 22 31893655 stop gained G/A snv
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.700 1.000 2 2013 2014
dbSNP: rs587777459
rs587777459 		0.882 0.040 22 31815005 stop gained C/G;T snv 2.0E-05
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.700 1.000 2 2013 2014
dbSNP: rs768241563
rs768241563 		0.925 0.040 22 31754942 stop gained C/G snv 4.0E-06 7.0E-06
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.700 1.000 2 2013 2014
dbSNP: rs786205703
rs786205703 		0.925 0.040 22 31778103 stop gained C/T snv
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.700 1.000 2 2014 2017
dbSNP: rs886039269
rs886039269 		0.925 0.040 22 31879713 stop gained C/T snv
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.700 1.000 2 2016 2016
dbSNP: rs587777458
rs587777458 		0.925 0.040 22 31857548 stop gained C/G;T snv 4.2E-06
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.700 1.000 1 2014 2014
dbSNP: rs797044545
rs797044545 		0.925 0.040 22 31838683 splice acceptor variant A/G snv
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.700 1.000 1 2014 2014
dbSNP: rs797044546
rs797044546 		0.925 0.040 22 31906252 stop gained C/T snv
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.700 1.000 1 2013 2013
dbSNP: rs886039255
rs886039255 		0.925 0.040 22 31797688 stop gained C/T snv
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.700 1.000 1 2016 2016
dbSNP: rs886039261
rs886039261 		0.925 0.040 22 31815101 stop gained C/T snv
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.700 1.000 1 2015 2015
dbSNP: rs886039268
rs886039268 		0.925 0.040 22 31876262 stop gained C/T snv
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.700 1.000 1 2013 2013
dbSNP: rs1060501487
rs1060501487 		1.000 0.040 22 31819199 frameshift variant G/- delins
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.700 0
dbSNP: rs1315483224
rs1315483224 		1.000 0.040 22 31766651 stop gained C/T snv 2.4E-05 1.4E-05
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.700 0
dbSNP: rs1555882867
rs1555882867 		1.000 0.040 22 31810520 splice acceptor variant G/C snv
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.700 0
dbSNP: rs1555882921
rs1555882921 		1.000 0.040 22 31810580 frameshift variant AT/- delins
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.700 0
dbSNP: rs1555900914
rs1555900914 		1.000 0.040 22 31845104 frameshift variant ACTGCGACATCTATGGGGACAGGCCC/- delins
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.700 0
dbSNP: rs1556607762
rs1556607762 		1.000 0.040 22 31797704 splice donor variant G/T snv
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.700 0
dbSNP: rs1569186093
rs1569186093 		1.000 0.040 22 31879587 stop gained C/T snv
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.700 0
dbSNP: rs759952667
rs759952667 		1.000 0.040 22 31797697 stop gained C/A;T snv
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.700 0
dbSNP: rs772872014
rs772872014 		0.925 0.040 22 31792777 stop gained C/T snv
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.700 0
dbSNP: rs541024038
rs541024038 		0.925 0.040 22 31843106 stop gained C/G;T snv 4.0E-06
CUI: C1858477
Disease: Epilepsy, Partial, with Variable Foci
Epilepsy, Partial, with Variable Foci 		Nervous System Diseases 0.010 1.000 1 2014 2014